ID: 936303444

View in Genome Browser
Species Human (GRCh38)
Location 2:111321023-111321045
Sequence GGCCTGCTGAGTCACACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936303437_936303444 23 Left 936303437 2:111320977-111320999 CCAGCCACCCTTTGGTTTTTAGT No data
Right 936303444 2:111321023-111321045 GGCCTGCTGAGTCACACTGCAGG No data
936303443_936303444 -7 Left 936303443 2:111321007-111321029 CCTGATAGCATCTGTTGGCCTGC No data
Right 936303444 2:111321023-111321045 GGCCTGCTGAGTCACACTGCAGG No data
936303440_936303444 15 Left 936303440 2:111320985-111321007 CCTTTGGTTTTTAGTGCTCTTCC No data
Right 936303444 2:111321023-111321045 GGCCTGCTGAGTCACACTGCAGG No data
936303438_936303444 19 Left 936303438 2:111320981-111321003 CCACCCTTTGGTTTTTAGTGCTC No data
Right 936303444 2:111321023-111321045 GGCCTGCTGAGTCACACTGCAGG No data
936303439_936303444 16 Left 936303439 2:111320984-111321006 CCCTTTGGTTTTTAGTGCTCTTC No data
Right 936303444 2:111321023-111321045 GGCCTGCTGAGTCACACTGCAGG No data
936303442_936303444 -6 Left 936303442 2:111321006-111321028 CCCTGATAGCATCTGTTGGCCTG No data
Right 936303444 2:111321023-111321045 GGCCTGCTGAGTCACACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936303444 Original CRISPR GGCCTGCTGAGTCACACTGC AGG Intergenic
No off target data available for this crispr