ID: 936304613

View in Genome Browser
Species Human (GRCh38)
Location 2:111329066-111329088
Sequence CCTGATGAGCATCCAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936304608_936304613 -6 Left 936304608 2:111329049-111329071 CCAGAGGGAGGATTTCCCCTGAT No data
Right 936304613 2:111329066-111329088 CCTGATGAGCATCCAGTGGAAGG No data
936304601_936304613 15 Left 936304601 2:111329028-111329050 CCATTTTCCCCACATCAGCATCC No data
Right 936304613 2:111329066-111329088 CCTGATGAGCATCCAGTGGAAGG No data
936304604_936304613 8 Left 936304604 2:111329035-111329057 CCCCACATCAGCATCCAGAGGGA No data
Right 936304613 2:111329066-111329088 CCTGATGAGCATCCAGTGGAAGG No data
936304605_936304613 7 Left 936304605 2:111329036-111329058 CCCACATCAGCATCCAGAGGGAG No data
Right 936304613 2:111329066-111329088 CCTGATGAGCATCCAGTGGAAGG No data
936304606_936304613 6 Left 936304606 2:111329037-111329059 CCACATCAGCATCCAGAGGGAGG No data
Right 936304613 2:111329066-111329088 CCTGATGAGCATCCAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936304613 Original CRISPR CCTGATGAGCATCCAGTGGA AGG Intergenic
No off target data available for this crispr