ID: 936317034

View in Genome Browser
Species Human (GRCh38)
Location 2:111432337-111432359
Sequence CTAGCTGGGGAGCTTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936317034_936317043 27 Left 936317034 2:111432337-111432359 CCTTCAGGAAGCTCCCCAGCTAG No data
Right 936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG No data
936317034_936317040 20 Left 936317034 2:111432337-111432359 CCTTCAGGAAGCTCCCCAGCTAG No data
Right 936317040 2:111432380-111432402 TCTTCCCGATAACAGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936317034 Original CRISPR CTAGCTGGGGAGCTTCCTGA AGG (reversed) Intergenic
No off target data available for this crispr