ID: 936317035

View in Genome Browser
Species Human (GRCh38)
Location 2:111432350-111432372
Sequence CATGATTTGGGAGCTAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936317035_936317040 7 Left 936317035 2:111432350-111432372 CCCCAGCTAGCTCCCAAATCATG No data
Right 936317040 2:111432380-111432402 TCTTCCCGATAACAGACAGAAGG No data
936317035_936317043 14 Left 936317035 2:111432350-111432372 CCCCAGCTAGCTCCCAAATCATG No data
Right 936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG No data
936317035_936317044 19 Left 936317035 2:111432350-111432372 CCCCAGCTAGCTCCCAAATCATG No data
Right 936317044 2:111432392-111432414 CAGACAGAAGGCTGCTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936317035 Original CRISPR CATGATTTGGGAGCTAGCTG GGG (reversed) Intergenic
No off target data available for this crispr