ID: 936317039

View in Genome Browser
Species Human (GRCh38)
Location 2:111432363-111432385
Sequence GGAAGAGAAAGAGCATGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936317039_936317045 20 Left 936317039 2:111432363-111432385 CCAAATCATGCTCTTTCTCTTCC No data
Right 936317045 2:111432406-111432428 CTGGCATGGTAAACTGACAAAGG No data
936317039_936317040 -6 Left 936317039 2:111432363-111432385 CCAAATCATGCTCTTTCTCTTCC No data
Right 936317040 2:111432380-111432402 TCTTCCCGATAACAGACAGAAGG No data
936317039_936317044 6 Left 936317039 2:111432363-111432385 CCAAATCATGCTCTTTCTCTTCC No data
Right 936317044 2:111432392-111432414 CAGACAGAAGGCTGCTGGCATGG No data
936317039_936317046 21 Left 936317039 2:111432363-111432385 CCAAATCATGCTCTTTCTCTTCC No data
Right 936317046 2:111432407-111432429 TGGCATGGTAAACTGACAAAGGG No data
936317039_936317043 1 Left 936317039 2:111432363-111432385 CCAAATCATGCTCTTTCTCTTCC No data
Right 936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936317039 Original CRISPR GGAAGAGAAAGAGCATGATT TGG (reversed) Intergenic
No off target data available for this crispr