ID: 936317043

View in Genome Browser
Species Human (GRCh38)
Location 2:111432387-111432409
Sequence GATAACAGACAGAAGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936317034_936317043 27 Left 936317034 2:111432337-111432359 CCTTCAGGAAGCTCCCCAGCTAG No data
Right 936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG No data
936317036_936317043 13 Left 936317036 2:111432351-111432373 CCCAGCTAGCTCCCAAATCATGC No data
Right 936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG No data
936317039_936317043 1 Left 936317039 2:111432363-111432385 CCAAATCATGCTCTTTCTCTTCC No data
Right 936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG No data
936317038_936317043 2 Left 936317038 2:111432362-111432384 CCCAAATCATGCTCTTTCTCTTC No data
Right 936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG No data
936317037_936317043 12 Left 936317037 2:111432352-111432374 CCAGCTAGCTCCCAAATCATGCT No data
Right 936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG No data
936317035_936317043 14 Left 936317035 2:111432350-111432372 CCCCAGCTAGCTCCCAAATCATG No data
Right 936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936317043 Original CRISPR GATAACAGACAGAAGGCTGC TGG Intergenic
No off target data available for this crispr