ID: 936318941

View in Genome Browser
Species Human (GRCh38)
Location 2:111449631-111449653
Sequence GCTGAGGTCACGGGGCACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936318930_936318941 9 Left 936318930 2:111449599-111449621 CCCTGAAATAACGGCCTCCCATC No data
Right 936318941 2:111449631-111449653 GCTGAGGTCACGGGGCACGGTGG No data
936318935_936318941 -8 Left 936318935 2:111449616-111449638 CCCATCTAATGGCACGCTGAGGT No data
Right 936318941 2:111449631-111449653 GCTGAGGTCACGGGGCACGGTGG No data
936318933_936318941 -5 Left 936318933 2:111449613-111449635 CCTCCCATCTAATGGCACGCTGA No data
Right 936318941 2:111449631-111449653 GCTGAGGTCACGGGGCACGGTGG No data
936318931_936318941 8 Left 936318931 2:111449600-111449622 CCTGAAATAACGGCCTCCCATCT No data
Right 936318941 2:111449631-111449653 GCTGAGGTCACGGGGCACGGTGG No data
936318936_936318941 -9 Left 936318936 2:111449617-111449639 CCATCTAATGGCACGCTGAGGTC No data
Right 936318941 2:111449631-111449653 GCTGAGGTCACGGGGCACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936318941 Original CRISPR GCTGAGGTCACGGGGCACGG TGG Intergenic