ID: 936320614

View in Genome Browser
Species Human (GRCh38)
Location 2:111464060-111464082
Sequence CGCCCACAGAGGCCGGCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936320614_936320627 16 Left 936320614 2:111464060-111464082 CCAGACGCCGGCCTCTGTGGGCG No data
Right 936320627 2:111464099-111464121 GCGTTGGTGCAGGCCTTCGTGGG No data
936320614_936320626 15 Left 936320614 2:111464060-111464082 CCAGACGCCGGCCTCTGTGGGCG No data
Right 936320626 2:111464098-111464120 TGCGTTGGTGCAGGCCTTCGTGG No data
936320614_936320624 6 Left 936320614 2:111464060-111464082 CCAGACGCCGGCCTCTGTGGGCG No data
Right 936320624 2:111464089-111464111 AGGGCACCGTGCGTTGGTGCAGG No data
936320614_936320621 0 Left 936320614 2:111464060-111464082 CCAGACGCCGGCCTCTGTGGGCG No data
Right 936320621 2:111464083-111464105 GCCCGGAGGGCACCGTGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936320614 Original CRISPR CGCCCACAGAGGCCGGCGTC TGG (reversed) Intergenic
No off target data available for this crispr