ID: 936327620

View in Genome Browser
Species Human (GRCh38)
Location 2:111519303-111519325
Sequence CTCCACCAGCAGTTTCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936327613_936327620 15 Left 936327613 2:111519265-111519287 CCAGAAGCAGAAATCCTTTTGTG No data
Right 936327620 2:111519303-111519325 CTCCACCAGCAGTTTCTCTAGGG No data
936327614_936327620 1 Left 936327614 2:111519279-111519301 CCTTTTGTGACAACATACTTCCC No data
Right 936327620 2:111519303-111519325 CTCCACCAGCAGTTTCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936327620 Original CRISPR CTCCACCAGCAGTTTCTCTA GGG Intergenic
No off target data available for this crispr