ID: 936327834

View in Genome Browser
Species Human (GRCh38)
Location 2:111520912-111520934
Sequence CAACTTTAGAATCTGGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936327829_936327834 14 Left 936327829 2:111520875-111520897 CCTGGTGACTCCAATTTAAAGTG No data
Right 936327834 2:111520912-111520934 CAACTTTAGAATCTGGATATTGG No data
936327828_936327834 26 Left 936327828 2:111520863-111520885 CCATTGGATTAGCCTGGTGACTC No data
Right 936327834 2:111520912-111520934 CAACTTTAGAATCTGGATATTGG No data
936327831_936327834 4 Left 936327831 2:111520885-111520907 CCAATTTAAAGTGTATAATTGGG No data
Right 936327834 2:111520912-111520934 CAACTTTAGAATCTGGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936327834 Original CRISPR CAACTTTAGAATCTGGATAT TGG Intergenic
No off target data available for this crispr