ID: 936332195 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:111557282-111557304 |
| Sequence | TATAGAATAGATAGGGGTGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 936332195_936332205 | 23 | Left | 936332195 | 2:111557282-111557304 | CCCCCACCCCTATCTATTCTATA | No data | ||
| Right | 936332205 | 2:111557328-111557350 | TAGGCCCATACCTAAGGACCAGG | No data | ||||
| 936332195_936332204 | 17 | Left | 936332195 | 2:111557282-111557304 | CCCCCACCCCTATCTATTCTATA | No data | ||
| Right | 936332204 | 2:111557322-111557344 | ACTATGTAGGCCCATACCTAAGG | No data | ||||
| 936332195_936332203 | 4 | Left | 936332195 | 2:111557282-111557304 | CCCCCACCCCTATCTATTCTATA | No data | ||
| Right | 936332203 | 2:111557309-111557331 | TTGGAAGAAAATCACTATGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 936332195 | Original CRISPR | TATAGAATAGATAGGGGTGG GGG (reversed) | Intergenic | ||