ID: 936332196

View in Genome Browser
Species Human (GRCh38)
Location 2:111557283-111557305
Sequence GTATAGAATAGATAGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936332196_936332205 22 Left 936332196 2:111557283-111557305 CCCCACCCCTATCTATTCTATAC No data
Right 936332205 2:111557328-111557350 TAGGCCCATACCTAAGGACCAGG No data
936332196_936332203 3 Left 936332196 2:111557283-111557305 CCCCACCCCTATCTATTCTATAC No data
Right 936332203 2:111557309-111557331 TTGGAAGAAAATCACTATGTAGG No data
936332196_936332204 16 Left 936332196 2:111557283-111557305 CCCCACCCCTATCTATTCTATAC No data
Right 936332204 2:111557322-111557344 ACTATGTAGGCCCATACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936332196 Original CRISPR GTATAGAATAGATAGGGGTG GGG (reversed) Intergenic