ID: 936332203

View in Genome Browser
Species Human (GRCh38)
Location 2:111557309-111557331
Sequence TTGGAAGAAAATCACTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936332196_936332203 3 Left 936332196 2:111557283-111557305 CCCCACCCCTATCTATTCTATAC No data
Right 936332203 2:111557309-111557331 TTGGAAGAAAATCACTATGTAGG No data
936332200_936332203 -3 Left 936332200 2:111557289-111557311 CCCTATCTATTCTATACTCTTTG No data
Right 936332203 2:111557309-111557331 TTGGAAGAAAATCACTATGTAGG No data
936332199_936332203 -2 Left 936332199 2:111557288-111557310 CCCCTATCTATTCTATACTCTTT No data
Right 936332203 2:111557309-111557331 TTGGAAGAAAATCACTATGTAGG No data
936332197_936332203 2 Left 936332197 2:111557284-111557306 CCCACCCCTATCTATTCTATACT No data
Right 936332203 2:111557309-111557331 TTGGAAGAAAATCACTATGTAGG No data
936332201_936332203 -4 Left 936332201 2:111557290-111557312 CCTATCTATTCTATACTCTTTGG No data
Right 936332203 2:111557309-111557331 TTGGAAGAAAATCACTATGTAGG No data
936332198_936332203 1 Left 936332198 2:111557285-111557307 CCACCCCTATCTATTCTATACTC No data
Right 936332203 2:111557309-111557331 TTGGAAGAAAATCACTATGTAGG No data
936332195_936332203 4 Left 936332195 2:111557282-111557304 CCCCCACCCCTATCTATTCTATA No data
Right 936332203 2:111557309-111557331 TTGGAAGAAAATCACTATGTAGG No data
936332194_936332203 22 Left 936332194 2:111557264-111557286 CCACTGTAAATCTACTTTCCCCC No data
Right 936332203 2:111557309-111557331 TTGGAAGAAAATCACTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936332203 Original CRISPR TTGGAAGAAAATCACTATGT AGG Intergenic