ID: 936332205

View in Genome Browser
Species Human (GRCh38)
Location 2:111557328-111557350
Sequence TAGGCCCATACCTAAGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936332196_936332205 22 Left 936332196 2:111557283-111557305 CCCCACCCCTATCTATTCTATAC No data
Right 936332205 2:111557328-111557350 TAGGCCCATACCTAAGGACCAGG No data
936332201_936332205 15 Left 936332201 2:111557290-111557312 CCTATCTATTCTATACTCTTTGG No data
Right 936332205 2:111557328-111557350 TAGGCCCATACCTAAGGACCAGG No data
936332199_936332205 17 Left 936332199 2:111557288-111557310 CCCCTATCTATTCTATACTCTTT No data
Right 936332205 2:111557328-111557350 TAGGCCCATACCTAAGGACCAGG No data
936332200_936332205 16 Left 936332200 2:111557289-111557311 CCCTATCTATTCTATACTCTTTG No data
Right 936332205 2:111557328-111557350 TAGGCCCATACCTAAGGACCAGG No data
936332198_936332205 20 Left 936332198 2:111557285-111557307 CCACCCCTATCTATTCTATACTC No data
Right 936332205 2:111557328-111557350 TAGGCCCATACCTAAGGACCAGG No data
936332195_936332205 23 Left 936332195 2:111557282-111557304 CCCCCACCCCTATCTATTCTATA No data
Right 936332205 2:111557328-111557350 TAGGCCCATACCTAAGGACCAGG No data
936332197_936332205 21 Left 936332197 2:111557284-111557306 CCCACCCCTATCTATTCTATACT No data
Right 936332205 2:111557328-111557350 TAGGCCCATACCTAAGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936332205 Original CRISPR TAGGCCCATACCTAAGGACC AGG Intergenic