ID: 936332205 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:111557328-111557350 |
Sequence | TAGGCCCATACCTAAGGACC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 7 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
936332196_936332205 | 22 | Left | 936332196 | 2:111557283-111557305 | CCCCACCCCTATCTATTCTATAC | No data | ||
Right | 936332205 | 2:111557328-111557350 | TAGGCCCATACCTAAGGACCAGG | No data | ||||
936332201_936332205 | 15 | Left | 936332201 | 2:111557290-111557312 | CCTATCTATTCTATACTCTTTGG | No data | ||
Right | 936332205 | 2:111557328-111557350 | TAGGCCCATACCTAAGGACCAGG | No data | ||||
936332199_936332205 | 17 | Left | 936332199 | 2:111557288-111557310 | CCCCTATCTATTCTATACTCTTT | No data | ||
Right | 936332205 | 2:111557328-111557350 | TAGGCCCATACCTAAGGACCAGG | No data | ||||
936332200_936332205 | 16 | Left | 936332200 | 2:111557289-111557311 | CCCTATCTATTCTATACTCTTTG | No data | ||
Right | 936332205 | 2:111557328-111557350 | TAGGCCCATACCTAAGGACCAGG | No data | ||||
936332198_936332205 | 20 | Left | 936332198 | 2:111557285-111557307 | CCACCCCTATCTATTCTATACTC | No data | ||
Right | 936332205 | 2:111557328-111557350 | TAGGCCCATACCTAAGGACCAGG | No data | ||||
936332195_936332205 | 23 | Left | 936332195 | 2:111557282-111557304 | CCCCCACCCCTATCTATTCTATA | No data | ||
Right | 936332205 | 2:111557328-111557350 | TAGGCCCATACCTAAGGACCAGG | No data | ||||
936332197_936332205 | 21 | Left | 936332197 | 2:111557284-111557306 | CCCACCCCTATCTATTCTATACT | No data | ||
Right | 936332205 | 2:111557328-111557350 | TAGGCCCATACCTAAGGACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
936332205 | Original CRISPR | TAGGCCCATACCTAAGGACC AGG | Intergenic | ||