ID: 936332729

View in Genome Browser
Species Human (GRCh38)
Location 2:111562565-111562587
Sequence AAGGAGAGACAGAAGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936332722_936332729 -5 Left 936332722 2:111562547-111562569 CCACAAACCCCAGGATGGAAGGA No data
Right 936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG No data
936332717_936332729 16 Left 936332717 2:111562526-111562548 CCGCAACTGGGTAATCCTCTACC No data
Right 936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG No data
936332719_936332729 1 Left 936332719 2:111562541-111562563 CCTCTACCACAAACCCCAGGATG No data
Right 936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936332729 Original CRISPR AAGGAGAGACAGAAGGGGCA TGG Intergenic
No off target data available for this crispr