ID: 936333448

View in Genome Browser
Species Human (GRCh38)
Location 2:111568396-111568418
Sequence GTTGAATAACTAGGAACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936333448_936333451 4 Left 936333448 2:111568396-111568418 CCTGTTGTTCCTAGTTATTCAAC No data
Right 936333451 2:111568423-111568445 GGACGCCATAAAAGAAAAAATGG No data
936333448_936333456 18 Left 936333448 2:111568396-111568418 CCTGTTGTTCCTAGTTATTCAAC No data
Right 936333456 2:111568437-111568459 AAAAAATGGGCTGGGCACAGTGG 0: 13
1: 199
2: 1749
3: 9315
4: 43792
936333448_936333454 9 Left 936333448 2:111568396-111568418 CCTGTTGTTCCTAGTTATTCAAC No data
Right 936333454 2:111568428-111568450 CCATAAAAGAAAAAATGGGCTGG No data
936333448_936333455 10 Left 936333448 2:111568396-111568418 CCTGTTGTTCCTAGTTATTCAAC No data
Right 936333455 2:111568429-111568451 CATAAAAGAAAAAATGGGCTGGG No data
936333448_936333452 5 Left 936333448 2:111568396-111568418 CCTGTTGTTCCTAGTTATTCAAC No data
Right 936333452 2:111568424-111568446 GACGCCATAAAAGAAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936333448 Original CRISPR GTTGAATAACTAGGAACAAC AGG (reversed) Intergenic
No off target data available for this crispr