ID: 936334233

View in Genome Browser
Species Human (GRCh38)
Location 2:111575049-111575071
Sequence CTGCATGTGGAGTTGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936334233_936334239 6 Left 936334233 2:111575049-111575071 CCCTCCCTCAACTCCACATGCAG No data
Right 936334239 2:111575078-111575100 AGCTGTCTAACAGCTTTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936334233 Original CRISPR CTGCATGTGGAGTTGAGGGA GGG (reversed) Intergenic
No off target data available for this crispr