ID: 936341482

View in Genome Browser
Species Human (GRCh38)
Location 2:111637353-111637375
Sequence ATTTCTTAACTTTAGAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3636
Summary {0: 1, 1: 1, 2: 24, 3: 454, 4: 3156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936341482_936341484 -7 Left 936341482 2:111637353-111637375 CCTTGTCTCTAAAGTTAAGAAAT 0: 1
1: 1
2: 24
3: 454
4: 3156
Right 936341484 2:111637369-111637391 AAGAAATAAAAATAAAATTTGGG No data
936341482_936341487 17 Left 936341482 2:111637353-111637375 CCTTGTCTCTAAAGTTAAGAAAT 0: 1
1: 1
2: 24
3: 454
4: 3156
Right 936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG 0: 1
1: 0
2: 0
3: 5
4: 98
936341482_936341486 16 Left 936341482 2:111637353-111637375 CCTTGTCTCTAAAGTTAAGAAAT 0: 1
1: 1
2: 24
3: 454
4: 3156
Right 936341486 2:111637392-111637414 GATTCAATCCAGTATCTATGTGG 0: 1
1: 0
2: 0
3: 7
4: 218
936341482_936341485 -6 Left 936341482 2:111637353-111637375 CCTTGTCTCTAAAGTTAAGAAAT 0: 1
1: 1
2: 24
3: 454
4: 3156
Right 936341485 2:111637370-111637392 AGAAATAAAAATAAAATTTGGGG 0: 1
1: 1
2: 61
3: 536
4: 5227
936341482_936341483 -8 Left 936341482 2:111637353-111637375 CCTTGTCTCTAAAGTTAAGAAAT 0: 1
1: 1
2: 24
3: 454
4: 3156
Right 936341483 2:111637368-111637390 TAAGAAATAAAAATAAAATTTGG 0: 1
1: 4
2: 80
3: 745
4: 6597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936341482 Original CRISPR ATTTCTTAACTTTAGAGACA AGG (reversed) Intergenic
Too many off-targets to display for this crispr