ID: 936341487

View in Genome Browser
Species Human (GRCh38)
Location 2:111637393-111637415
Sequence ATTCAATCCAGTATCTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936341482_936341487 17 Left 936341482 2:111637353-111637375 CCTTGTCTCTAAAGTTAAGAAAT 0: 1
1: 1
2: 24
3: 454
4: 3156
Right 936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG 0: 1
1: 0
2: 0
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936341487 Original CRISPR ATTCAATCCAGTATCTATGT GGG Intergenic
905544897 1:38789990-38790012 ACTCAATCCAAAATCTATGTGGG - Intergenic
910659154 1:89652237-89652259 ATTGAAAACAGGATCTATGTGGG + Intronic
916091789 1:161313281-161313303 ATCCAATCTACTATCTATGCAGG - Intergenic
918710609 1:187723700-187723722 CTTCAATGCTGTATATATGTGGG + Intergenic
919592571 1:199522920-199522942 ATTCCTTCTAGTATCTATATGGG + Intergenic
924256191 1:242185210-242185232 ATTCATTGGAGTAGCTATGTGGG - Intronic
1063289727 10:4733222-4733244 AGCCAACCCAGAATCTATGTGGG - Intergenic
1066929184 10:41735374-41735396 CTTCTTTCCAGTTTCTATGTGGG - Intergenic
1067338410 10:45382077-45382099 ATTCAATGCAGTATCTAAGGGGG - Intronic
1071547858 10:86542076-86542098 ATTCAATCATGTATTTATATTGG - Intergenic
1071800230 10:89051703-89051725 ATATAATCCAGTATCCAGGTGGG + Intergenic
1074937284 10:118194047-118194069 ATTCTTTCCAGTATCAATTTGGG + Intergenic
1075295348 10:121270396-121270418 TATCAATCCAGTATCTATCTGGG + Intergenic
1075692527 10:124407950-124407972 ATTCAAACCACAGTCTATGTAGG + Intronic
1078544500 11:12237161-12237183 ATTCAACCCATTATCTGTGATGG + Intronic
1086809521 11:91290375-91290397 ATTCAATCCATCATTTGTGTTGG - Intergenic
1090592364 11:128286049-128286071 ATTAAATACAGTAACTATGGAGG - Intergenic
1091304095 11:134525863-134525885 ACTCAATCCTGAATCTATGCAGG - Intergenic
1091942362 12:4499485-4499507 CTTCTAACCAGTTTCTATGTGGG + Intronic
1094024736 12:25950763-25950785 ATTCAAACCAGTCTCCATGAAGG + Intergenic
1102769194 12:115458743-115458765 ATGCAAGTCAGTATATATGTTGG + Intergenic
1103028474 12:117593144-117593166 AGACAGTCCTGTATCTATGTGGG - Intronic
1103182440 12:118925444-118925466 TATTAATCCAGAATCTATGTAGG - Intergenic
1108109517 13:47053698-47053720 ATTCAAACCAGTATATTTCTTGG - Intergenic
1109957177 13:69583402-69583424 GTTCATTTCAGCATCTATGTCGG + Intergenic
1111202272 13:84954275-84954297 ATTCAATCCAGAGTCCAGGTAGG + Intergenic
1111410745 13:87873488-87873510 ATCCAATCCAATATCTTTATTGG - Intergenic
1111877296 13:93913159-93913181 TTTCAATTCATTCTCTATGTAGG - Intronic
1113405375 13:110033978-110034000 ATGCAATCCAGCATCTAAGTAGG + Intergenic
1117139863 14:52778199-52778221 TTTCAGTCCAGTATTTATGGAGG + Exonic
1126064159 15:44812255-44812277 TTTCAATTCAGTATATTTGTAGG + Intergenic
1127878743 15:63136584-63136606 ATTTGATACAGTATCTATTTGGG + Intronic
1130247897 15:82270076-82270098 CTTCATACCAGTATCTATGATGG - Intronic
1136744063 16:32567785-32567807 CTTCTATCCAGTTTTTATGTAGG - Intergenic
1203025535 16_KI270728v1_random:507448-507470 CTTCTATCCAGTTTTTATGTAGG + Intergenic
1203046186 16_KI270728v1_random:826983-827005 CTTCTATCCAGTTTTTATGTAGG - Intergenic
1146070524 17:29676827-29676849 ATTCAAACCTGTATCTGTGCAGG - Exonic
1151855469 17:76718445-76718467 ATTGAATCCATTTTCTATCTTGG - Intronic
1153570963 18:6473321-6473343 AGTCCATCCAGTCTCTCTGTTGG - Intergenic
1158119604 18:54033897-54033919 AAGCAATCTAGTATCTATTTTGG - Intergenic
926482116 2:13412325-13412347 ATTCAATCAAGTACCTCTATTGG + Intergenic
926879027 2:17520279-17520301 ATTGAAACCACTATTTATGTGGG + Intergenic
927809817 2:26174602-26174624 ATTCAATCCATAATCTTTATTGG - Intronic
928006369 2:27565719-27565741 AGTCTATCCAGTATCTGTGGTGG - Intronic
932044704 2:68336092-68336114 ATTCATTCCTGTTACTATGTTGG + Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
941809308 2:169739358-169739380 ATTAAATCCAGATTCTTTGTTGG + Intronic
944645342 2:201774270-201774292 ATGCCATCCAGAATATATGTGGG + Intronic
1177083253 21:16668656-16668678 ATCCAATCCAGTATCTTTACAGG - Intergenic
1177385133 21:20398729-20398751 GTTCAATCCAGAATCTGTGCAGG + Intergenic
1178472360 21:32904891-32904913 ATTCAATCAAGTATGAATCTGGG - Intergenic
1185004420 22:48267369-48267391 TTTCAATCGAGCATTTATGTTGG - Intergenic
949460070 3:4282136-4282158 GTTAAATCCAGTAACAATGTAGG + Intronic
950229079 3:11260227-11260249 ATTCAAGACAGTATGTATCTGGG + Exonic
953107369 3:39897071-39897093 AATCAATTCAGTAATTATGTTGG + Intronic
961221610 3:125205404-125205426 TTTCACTCCAGTTTCTAGGTGGG + Intronic
965128684 3:164666095-164666117 ACTTAATCCAGAATTTATGTAGG + Intergenic
965789536 3:172372844-172372866 AGTCAATGCAATATTTATGTTGG - Intronic
967812673 3:193773839-193773861 ACTCAATCCACACTCTATGTAGG + Intergenic
972135124 4:35883514-35883536 ATTTTATACAGTATCTATTTTGG + Intergenic
975116136 4:70683245-70683267 ATTTAATCTAGTGTCTATCTTGG + Intronic
979913508 4:126401762-126401784 ATAAAATACAGTATCAATGTTGG - Intergenic
983633041 4:169869306-169869328 AATGAATCCAGTACATATGTAGG - Intergenic
983722914 4:170880233-170880255 ATTCACTCCAGTCATTATGTAGG + Intergenic
987108373 5:14662975-14662997 ATTGAATCCAGAATCTCTGGTGG + Intergenic
988458239 5:31407605-31407627 GTTCATTCCATTATCTTTGTTGG - Intronic
990089797 5:52028933-52028955 ATTCATTTCAGCATCTATTTGGG - Intronic
990929324 5:61070110-61070132 ATTTAATCCAATATATGTGTAGG - Intronic
991915543 5:71601138-71601160 ATGCAATCTAGTATTTTTGTGGG + Intronic
992063494 5:73081875-73081897 ATACAATCCAGAAGCTATGGTGG + Exonic
995554704 5:113315487-113315509 ATTCAAACGACTTTCTATGTTGG - Intronic
996206714 5:120746912-120746934 ATTTTATCCAATAACTATGTTGG - Intergenic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
1004651148 6:17610367-17610389 ATTCAGATTAGTATCTATGTAGG + Exonic
1008825804 6:55692247-55692269 ATTCAAACAAGTGTCTATTTCGG + Intergenic
1017335781 6:153258140-153258162 AATCCATCCAGTTTCAATGTAGG - Intergenic
1018406633 6:163491175-163491197 ATTCAATCCATTATATCTTTTGG + Intronic
1019190796 6:170249475-170249497 AATCCATCCTGTATCTATGTGGG - Intergenic
1022297057 7:29066108-29066130 AGTTTATCCAGTATCTAGGTTGG + Exonic
1023305442 7:38821265-38821287 ATACAATCCATTTTCTTTGTAGG - Exonic
1023525309 7:41096392-41096414 ATTCAAAAGAGTGTCTATGTAGG - Intergenic
1027381110 7:77610394-77610416 ATTCAATGTATAATCTATGTGGG - Intronic
1031579818 7:123459152-123459174 TTTCAGTACCGTATCTATGTAGG - Intronic
1031609903 7:123813426-123813448 ATACAATCCAGTTTCTTTATAGG + Intergenic
1037087794 8:14874506-14874528 ATTTAAGCCAATATTTATGTGGG - Intronic
1037749632 8:21672803-21672825 ATACAAGCCACTATCTATGGGGG - Intergenic
1041158926 8:55017697-55017719 TTTCAATCAAGTATTTATCTGGG - Intergenic
1043120544 8:76317422-76317444 ATTCAATCAAGTAGCAATCTAGG + Intergenic
1043818096 8:84828457-84828479 TTTCAAGCCAGTATTTATGGAGG + Intronic
1043823499 8:84897048-84897070 ATTCAATTCCATTTCTATGTAGG - Intronic
1044158002 8:88874301-88874323 ATACAATCAAGTATGTATTTAGG - Intergenic
1045194138 8:99912857-99912879 ATTCAATACAATAGATATGTTGG - Intergenic
1046970013 8:120212464-120212486 ACTCAATTCAATATCTGTGTGGG - Exonic
1048909813 8:139124354-139124376 ATTCTTTCTAGTATCTCTGTAGG - Intergenic
1052161509 9:25266148-25266170 ATTAAATCAAGTATCTAGATTGG + Intergenic
1055824819 9:80311386-80311408 ATTCAGCCCACTATCTATTTTGG + Intergenic
1188140532 X:26545033-26545055 AATCAATCCAATATTAATGTAGG + Intergenic
1189871617 X:45389895-45389917 ATTCAATCCTTTACTTATGTTGG + Intergenic
1194315536 X:92372087-92372109 ATTAAAGCCAGAATCCATGTAGG + Intronic
1196577125 X:117332241-117332263 CTGCATTCAAGTATCTATGTGGG - Intergenic
1197013501 X:121595424-121595446 AATCAATCAAGGATGTATGTAGG - Intergenic
1200623584 Y:5483626-5483648 ATTAAAGCCAGAATCCATGTAGG + Intronic
1201692040 Y:16778227-16778249 TTTCAATTCAGTGTCTATGAGGG + Intergenic
1202237384 Y:22727246-22727268 ATTCAGATTAGTATCTATGTAGG + Intergenic