ID: 936348165

View in Genome Browser
Species Human (GRCh38)
Location 2:111690969-111690991
Sequence CCTCAAGATGAGATGTTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936348165_936348173 17 Left 936348165 2:111690969-111690991 CCAAATAACATCTCATCTTGAGG No data
Right 936348173 2:111691009-111691031 GAGGCATCCTAACACCCTGCTGG No data
936348165_936348177 28 Left 936348165 2:111690969-111690991 CCAAATAACATCTCATCTTGAGG No data
Right 936348177 2:111691020-111691042 ACACCCTGCTGGGGTAACACTGG No data
936348165_936348174 18 Left 936348165 2:111690969-111690991 CCAAATAACATCTCATCTTGAGG No data
Right 936348174 2:111691010-111691032 AGGCATCCTAACACCCTGCTGGG No data
936348165_936348169 -2 Left 936348165 2:111690969-111690991 CCAAATAACATCTCATCTTGAGG No data
Right 936348169 2:111690990-111691012 GGGTCCCTGGTCCAACTTAGAGG No data
936348165_936348175 19 Left 936348165 2:111690969-111690991 CCAAATAACATCTCATCTTGAGG No data
Right 936348175 2:111691011-111691033 GGCATCCTAACACCCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936348165 Original CRISPR CCTCAAGATGAGATGTTATT TGG (reversed) Intergenic
No off target data available for this crispr