ID: 936348171

View in Genome Browser
Species Human (GRCh38)
Location 2:111690995-111691017
Sequence GGATGCCTCTAAGTTGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936348171_936348180 11 Left 936348171 2:111690995-111691017 CCTGGTCCAACTTAGAGGCATCC No data
Right 936348180 2:111691029-111691051 TGGGGTAACACTGGAAGATTTGG No data
936348171_936348174 -8 Left 936348171 2:111690995-111691017 CCTGGTCCAACTTAGAGGCATCC No data
Right 936348174 2:111691010-111691032 AGGCATCCTAACACCCTGCTGGG No data
936348171_936348173 -9 Left 936348171 2:111690995-111691017 CCTGGTCCAACTTAGAGGCATCC No data
Right 936348173 2:111691009-111691031 GAGGCATCCTAACACCCTGCTGG No data
936348171_936348175 -7 Left 936348171 2:111690995-111691017 CCTGGTCCAACTTAGAGGCATCC No data
Right 936348175 2:111691011-111691033 GGCATCCTAACACCCTGCTGGGG No data
936348171_936348177 2 Left 936348171 2:111690995-111691017 CCTGGTCCAACTTAGAGGCATCC No data
Right 936348177 2:111691020-111691042 ACACCCTGCTGGGGTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936348171 Original CRISPR GGATGCCTCTAAGTTGGACC AGG (reversed) Intergenic
No off target data available for this crispr