ID: 936348172

View in Genome Browser
Species Human (GRCh38)
Location 2:111691001-111691023
Sequence GTGTTAGGATGCCTCTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936348172_936348180 5 Left 936348172 2:111691001-111691023 CCAACTTAGAGGCATCCTAACAC No data
Right 936348180 2:111691029-111691051 TGGGGTAACACTGGAAGATTTGG No data
936348172_936348177 -4 Left 936348172 2:111691001-111691023 CCAACTTAGAGGCATCCTAACAC No data
Right 936348177 2:111691020-111691042 ACACCCTGCTGGGGTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936348172 Original CRISPR GTGTTAGGATGCCTCTAAGT TGG (reversed) Intergenic
No off target data available for this crispr