ID: 936348177

View in Genome Browser
Species Human (GRCh38)
Location 2:111691020-111691042
Sequence ACACCCTGCTGGGGTAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936348170_936348177 3 Left 936348170 2:111690994-111691016 CCCTGGTCCAACTTAGAGGCATC No data
Right 936348177 2:111691020-111691042 ACACCCTGCTGGGGTAACACTGG No data
936348165_936348177 28 Left 936348165 2:111690969-111690991 CCAAATAACATCTCATCTTGAGG No data
Right 936348177 2:111691020-111691042 ACACCCTGCTGGGGTAACACTGG No data
936348171_936348177 2 Left 936348171 2:111690995-111691017 CCTGGTCCAACTTAGAGGCATCC No data
Right 936348177 2:111691020-111691042 ACACCCTGCTGGGGTAACACTGG No data
936348172_936348177 -4 Left 936348172 2:111691001-111691023 CCAACTTAGAGGCATCCTAACAC No data
Right 936348177 2:111691020-111691042 ACACCCTGCTGGGGTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936348177 Original CRISPR ACACCCTGCTGGGGTAACAC TGG Intergenic
No off target data available for this crispr