ID: 936349760

View in Genome Browser
Species Human (GRCh38)
Location 2:111703779-111703801
Sequence CCTGGCACAGGGAAGGTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936349760_936349766 -8 Left 936349760 2:111703779-111703801 CCCGGCACCTTCCCTGTGCCAGG No data
Right 936349766 2:111703794-111703816 GTGCCAGGAGCCCTGAGCCCTGG No data
936349760_936349767 -7 Left 936349760 2:111703779-111703801 CCCGGCACCTTCCCTGTGCCAGG No data
Right 936349767 2:111703795-111703817 TGCCAGGAGCCCTGAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936349760 Original CRISPR CCTGGCACAGGGAAGGTGCC GGG (reversed) Intergenic
No off target data available for this crispr