ID: 936349859

View in Genome Browser
Species Human (GRCh38)
Location 2:111704325-111704347
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936349852_936349859 4 Left 936349852 2:111704298-111704320 CCAACAGATGAACTGTCTGCTGG No data
Right 936349859 2:111704325-111704347 TGGGCATGTCCACAGTACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr