ID: 936350100

View in Genome Browser
Species Human (GRCh38)
Location 2:111706152-111706174
Sequence ACTTGGGCTTAGAGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936350100_936350112 23 Left 936350100 2:111706152-111706174 CCACCTTCCCTCTAAGCCCAAGT No data
Right 936350112 2:111706198-111706220 CCTCCCTCAGACCATAATGGTGG No data
936350100_936350107 -3 Left 936350100 2:111706152-111706174 CCACCTTCCCTCTAAGCCCAAGT No data
Right 936350107 2:111706172-111706194 AGTGACTAAGAAAAGCTGGCAGG No data
936350100_936350105 -7 Left 936350100 2:111706152-111706174 CCACCTTCCCTCTAAGCCCAAGT No data
Right 936350105 2:111706168-111706190 CCCAAGTGACTAAGAAAAGCTGG No data
936350100_936350108 -2 Left 936350100 2:111706152-111706174 CCACCTTCCCTCTAAGCCCAAGT No data
Right 936350108 2:111706173-111706195 GTGACTAAGAAAAGCTGGCAGGG No data
936350100_936350109 20 Left 936350100 2:111706152-111706174 CCACCTTCCCTCTAAGCCCAAGT No data
Right 936350109 2:111706195-111706217 GACCCTCCCTCAGACCATAATGG No data
936350100_936350113 24 Left 936350100 2:111706152-111706174 CCACCTTCCCTCTAAGCCCAAGT No data
Right 936350113 2:111706199-111706221 CTCCCTCAGACCATAATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936350100 Original CRISPR ACTTGGGCTTAGAGGGAAGG TGG (reversed) Intergenic
No off target data available for this crispr