ID: 936352840

View in Genome Browser
Species Human (GRCh38)
Location 2:111726184-111726206
Sequence GAGTGTGTCAGCAGAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936352840_936352843 -6 Left 936352840 2:111726184-111726206 CCCTCCACTCTGCTGACACACTC No data
Right 936352843 2:111726201-111726223 ACACTCCCACTACAAGACCCTGG No data
936352840_936352849 24 Left 936352840 2:111726184-111726206 CCCTCCACTCTGCTGACACACTC No data
Right 936352849 2:111726231-111726253 AGCCCTCCGTGATAGCTCCTTGG No data
936352840_936352852 29 Left 936352840 2:111726184-111726206 CCCTCCACTCTGCTGACACACTC No data
Right 936352852 2:111726236-111726258 TCCGTGATAGCTCCTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936352840 Original CRISPR GAGTGTGTCAGCAGAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr