ID: 936352966

View in Genome Browser
Species Human (GRCh38)
Location 2:111727095-111727117
Sequence CTGCAACCAGCAGGGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936352956_936352966 16 Left 936352956 2:111727056-111727078 CCGCCAGTGTGCACACCGCAGTT No data
Right 936352966 2:111727095-111727117 CTGCAACCAGCAGGGGTGAAAGG No data
936352961_936352966 1 Left 936352961 2:111727071-111727093 CCGCAGTTGGCAGGGACCTTGTC No data
Right 936352966 2:111727095-111727117 CTGCAACCAGCAGGGGTGAAAGG No data
936352955_936352966 17 Left 936352955 2:111727055-111727077 CCCGCCAGTGTGCACACCGCAGT No data
Right 936352966 2:111727095-111727117 CTGCAACCAGCAGGGGTGAAAGG No data
936352958_936352966 13 Left 936352958 2:111727059-111727081 CCAGTGTGCACACCGCAGTTGGC No data
Right 936352966 2:111727095-111727117 CTGCAACCAGCAGGGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936352966 Original CRISPR CTGCAACCAGCAGGGGTGAA AGG Intergenic
No off target data available for this crispr