ID: 936354808

View in Genome Browser
Species Human (GRCh38)
Location 2:111740654-111740676
Sequence GGCCAAGGACACTGGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936354799_936354808 17 Left 936354799 2:111740614-111740636 CCAGGGAGGTGGGGAAACCAGCA No data
Right 936354808 2:111740654-111740676 GGCCAAGGACACTGGCCCTGGGG No data
936354803_936354808 -9 Left 936354803 2:111740640-111740662 CCTGAGATCTCCAAGGCCAAGGA No data
Right 936354808 2:111740654-111740676 GGCCAAGGACACTGGCCCTGGGG No data
936354800_936354808 0 Left 936354800 2:111740631-111740653 CCAGCAGAGCCTGAGATCTCCAA No data
Right 936354808 2:111740654-111740676 GGCCAAGGACACTGGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936354808 Original CRISPR GGCCAAGGACACTGGCCCTG GGG Intergenic
No off target data available for this crispr