ID: 936357125

View in Genome Browser
Species Human (GRCh38)
Location 2:111761447-111761469
Sequence GGAAACTGGTCTGGGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936357125_936357131 3 Left 936357125 2:111761447-111761469 CCAGGACACCCAGACCAGTTTCC No data
Right 936357131 2:111761473-111761495 CATAGACACTTGGTTACAGCTGG 0: 46
1: 36
2: 24
3: 18
4: 88
936357125_936357129 -7 Left 936357125 2:111761447-111761469 CCAGGACACCCAGACCAGTTTCC No data
Right 936357129 2:111761463-111761485 AGTTTCCGTACATAGACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936357125 Original CRISPR GGAAACTGGTCTGGGTGTCC TGG (reversed) Intergenic
No off target data available for this crispr