ID: 936358848

View in Genome Browser
Species Human (GRCh38)
Location 2:111777359-111777381
Sequence ACCCAGCTCGAGTTTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 1, 2: 8, 3: 45, 4: 226}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936358848_936358850 2 Left 936358848 2:111777359-111777381 CCTCTGGGAAACTCGAGCTGGGT 0: 1
1: 1
2: 8
3: 45
4: 226
Right 936358850 2:111777384-111777406 AATGACATGGCAGAGATCCCAGG 0: 2
1: 0
2: 0
3: 10
4: 153
936358848_936358853 5 Left 936358848 2:111777359-111777381 CCTCTGGGAAACTCGAGCTGGGT 0: 1
1: 1
2: 8
3: 45
4: 226
Right 936358853 2:111777387-111777409 GACATGGCAGAGATCCCAGGGGG 0: 2
1: 0
2: 5
3: 16
4: 239
936358848_936358854 11 Left 936358848 2:111777359-111777381 CCTCTGGGAAACTCGAGCTGGGT 0: 1
1: 1
2: 8
3: 45
4: 226
Right 936358854 2:111777393-111777415 GCAGAGATCCCAGGGGGTAGAGG 0: 2
1: 0
2: 3
3: 35
4: 279
936358848_936358851 3 Left 936358848 2:111777359-111777381 CCTCTGGGAAACTCGAGCTGGGT 0: 1
1: 1
2: 8
3: 45
4: 226
Right 936358851 2:111777385-111777407 ATGACATGGCAGAGATCCCAGGG 0: 2
1: 0
2: 2
3: 16
4: 190
936358848_936358852 4 Left 936358848 2:111777359-111777381 CCTCTGGGAAACTCGAGCTGGGT 0: 1
1: 1
2: 8
3: 45
4: 226
Right 936358852 2:111777386-111777408 TGACATGGCAGAGATCCCAGGGG 0: 2
1: 0
2: 3
3: 15
4: 229
936358848_936358855 12 Left 936358848 2:111777359-111777381 CCTCTGGGAAACTCGAGCTGGGT 0: 1
1: 1
2: 8
3: 45
4: 226
Right 936358855 2:111777394-111777416 CAGAGATCCCAGGGGGTAGAGGG 0: 2
1: 0
2: 1
3: 30
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936358848 Original CRISPR ACCCAGCTCGAGTTTCCCAG AGG (reversed) Intronic