ID: 936363635

View in Genome Browser
Species Human (GRCh38)
Location 2:111831285-111831307
Sequence AAGAAGCAGACTTGTAGTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 3, 1: 0, 2: 0, 3: 17, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936363635_936363640 6 Left 936363635 2:111831285-111831307 CCAAGACTACAAGTCTGCTTCTT 0: 3
1: 0
2: 0
3: 17
4: 188
Right 936363640 2:111831314-111831336 ATTCCAGGGAGGTAAGGATAAGG 0: 3
1: 0
2: 3
3: 14
4: 213
936363635_936363637 -8 Left 936363635 2:111831285-111831307 CCAAGACTACAAGTCTGCTTCTT 0: 3
1: 0
2: 0
3: 17
4: 188
Right 936363637 2:111831300-111831322 TGCTTCTTTCACAGATTCCAGGG 0: 3
1: 0
2: 1
3: 27
4: 303
936363635_936363639 0 Left 936363635 2:111831285-111831307 CCAAGACTACAAGTCTGCTTCTT 0: 3
1: 0
2: 0
3: 17
4: 188
Right 936363639 2:111831308-111831330 TCACAGATTCCAGGGAGGTAAGG 0: 3
1: 0
2: 2
3: 20
4: 280
936363635_936363638 -5 Left 936363635 2:111831285-111831307 CCAAGACTACAAGTCTGCTTCTT 0: 3
1: 0
2: 0
3: 17
4: 188
Right 936363638 2:111831303-111831325 TTCTTTCACAGATTCCAGGGAGG 0: 3
1: 0
2: 1
3: 12
4: 200
936363635_936363642 9 Left 936363635 2:111831285-111831307 CCAAGACTACAAGTCTGCTTCTT 0: 3
1: 0
2: 0
3: 17
4: 188
Right 936363642 2:111831317-111831339 CCAGGGAGGTAAGGATAAGGTGG 0: 3
1: 0
2: 3
3: 31
4: 299
936363635_936363636 -9 Left 936363635 2:111831285-111831307 CCAAGACTACAAGTCTGCTTCTT 0: 3
1: 0
2: 0
3: 17
4: 188
Right 936363636 2:111831299-111831321 CTGCTTCTTTCACAGATTCCAGG 0: 3
1: 0
2: 3
3: 17
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936363635 Original CRISPR AAGAAGCAGACTTGTAGTCT TGG (reversed) Exonic
905445379 1:38025372-38025394 AGGAAACAGGCTTCTAGTCTAGG - Intergenic
906814349 1:48862614-48862636 AAGAAAGTGACTTTTAGTCTGGG - Intronic
906943695 1:50277618-50277640 AAGAAGCAGGCTTATTGTATTGG - Intergenic
907366340 1:53963820-53963842 AAGGAGCATACTTGTTCTCTCGG - Intronic
907812619 1:57886754-57886776 AAGAACCTGAGTTCTAGTCTTGG + Intronic
908595783 1:65687518-65687540 AAGAGGCAGACTAGGAGTCTAGG + Intergenic
909754703 1:79210140-79210162 TAGAAGGCAACTTGTAGTCTGGG + Intergenic
910159429 1:84257707-84257729 AAGAAGCAGTCTTGTGGTCAAGG + Intergenic
911309796 1:96278146-96278168 ATGGAGCAGGCTTGGAGTCTGGG + Intergenic
912690679 1:111802444-111802466 AAGATGCAGACTTGCAGGCCAGG - Intronic
913500714 1:119470318-119470340 CAGAAGCAGAATTGTAGTGTAGG - Intergenic
913515766 1:119604437-119604459 CAGAAGCAGAATTGTAATGTAGG - Intergenic
916014509 1:160737387-160737409 AAGAAGAAAACTTGAAGGCTGGG + Intergenic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
917744580 1:177995411-177995433 AAGAACCAGACTTTGAGTCTAGG + Intergenic
920133289 1:203749558-203749580 AAGAAGCAGAGTTGAGGTCAGGG - Intergenic
920816835 1:209342553-209342575 CAGAAGATGACTTGTAATCTGGG - Intergenic
921174238 1:212579847-212579869 AAGAAACAGATTTGTAGACTGGG + Intronic
921348042 1:214207318-214207340 AAGAAGCAGAGTTGGGGTCCAGG + Intergenic
923199316 1:231695954-231695976 CAGATGCAGGCTTGTATTCTGGG + Intronic
1063119680 10:3096621-3096643 AGGAAGCAGGCATGTAGCCTGGG - Intronic
1063442318 10:6082840-6082862 AAGAAACAGAAGTGTAGACTTGG - Intergenic
1064475239 10:15681297-15681319 AAGAAGCAGACTTCCCGTCATGG - Intronic
1064677949 10:17780675-17780697 ATGAAGCAGTGTTGTTGTCTGGG + Intronic
1069438848 10:68409555-68409577 AAAAAGATGACTTGTAGGCTGGG - Intergenic
1075473932 10:122717057-122717079 AAATAGCAGACTAGTAGACTAGG + Intergenic
1080553154 11:33391593-33391615 GAGAAGGAGACTGGGAGTCTTGG + Intergenic
1080951701 11:37041235-37041257 AAAAAGGTGGCTTGTAGTCTGGG - Intergenic
1084396019 11:68910898-68910920 AAGAAGCAGATCTTTAGTCTTGG + Intronic
1086304941 11:85469771-85469793 AAGAAGCCAATTTCTAGTCTAGG + Intronic
1086520644 11:87664436-87664458 AAGTAACATGCTTGTAGTCTAGG + Intergenic
1088566755 11:111180683-111180705 TAGAAGCAGACGTGTTTTCTAGG - Intergenic
1088666545 11:112099373-112099395 AAGAAGAAGACTAGAACTCTGGG - Intronic
1090083488 11:123630529-123630551 GAGAAACAGACATCTAGTCTGGG + Exonic
1096699102 12:53370770-53370792 AAGAAGTAGAATTGTAGTCAGGG + Intergenic
1097909501 12:64954438-64954460 AAGATGCAGACTCTTAATCTTGG + Intergenic
1102198924 12:111044163-111044185 AAGAAACAGACTTGAAGGCAGGG - Intronic
1102371278 12:112383887-112383909 AATAATCAGACTCGTAGTCAAGG + Intergenic
1104116623 12:125755194-125755216 AAGAAGCAAATTTGAAATCTTGG - Intergenic
1104890362 12:132136498-132136520 GTGAAGCAGCCTTGTGGTCTGGG + Intergenic
1105442519 13:20427266-20427288 ATGAAGCAGCCCTGTGGTCTTGG - Intronic
1105719681 13:23101308-23101330 AAGAAGCTGTGTTGCAGTCTGGG + Intergenic
1106369660 13:29118964-29118986 AAGAAGCAAACTTGTGTTCGAGG - Intronic
1107875326 13:44785639-44785661 CAGAAGCAGGCTTGTATTCATGG - Intergenic
1108036559 13:46296250-46296272 AAGAAGCAGACTTCCTGCCTTGG + Intergenic
1111564172 13:89992681-89992703 AACAATCAGAGTTATAGTCTAGG - Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114370131 14:22077358-22077380 AAGAAGGAGCCCTGTATTCTTGG + Intergenic
1114595274 14:23906734-23906756 AAAAAGAAGACTTGAGGTCTGGG - Intergenic
1114791375 14:25662301-25662323 AATAATCAGAATTGTATTCTAGG + Intergenic
1115211905 14:30975617-30975639 AGGAAGTAGACTTGAAGCCTGGG + Intronic
1115507359 14:34105178-34105200 GAGAAGCAGCCTTGTCCTCTGGG - Intronic
1115535169 14:34366263-34366285 AAAAAGCCAACTTGTAGGCTGGG + Intronic
1116432811 14:44866525-44866547 AAGGAGCAGGCATGGAGTCTGGG + Intergenic
1125318651 15:38458895-38458917 AAGAAGCAGACAAGTTGTCCAGG + Intronic
1127820641 15:62652526-62652548 AGGAGGCAGACTTGTTCTCTGGG - Intronic
1128267057 15:66276114-66276136 AAGCTGCAGACTTGGAGCCTTGG + Intergenic
1130549358 15:84879951-84879973 AAGAAGCAGCAGTGTGGTCTCGG - Intergenic
1130694306 15:86114833-86114855 GAGAAACAGACTTGTAGCGTTGG - Intergenic
1131375735 15:91921453-91921475 AAGAGGCAGGAGTGTAGTCTTGG - Intronic
1131832672 15:96363714-96363736 AAGAAGCAGACACTTAGGCTGGG + Intergenic
1132818227 16:1845965-1845987 AGGTAGGAGACTTGTATTCTGGG - Intronic
1133604233 16:7370297-7370319 AAGAAGCAGACATGTTATCTAGG + Intronic
1138316488 16:56074287-56074309 AAGAAGCAGAGTTATTGGCTGGG - Intergenic
1140604985 16:76524976-76524998 AAAAAAAACACTTGTAGTCTTGG + Intronic
1140870095 16:79098367-79098389 AAGAAGCAGAAATGCACTCTAGG - Intronic
1141417583 16:83888340-83888362 AAGAAGCAGCCTCGTTGTATGGG + Intergenic
1143371962 17:6445861-6445883 GAGAGCCAGAATTGTAGTCTGGG + Intronic
1144805070 17:17959823-17959845 AAGCATAAGCCTTGTAGTCTGGG - Intronic
1145110658 17:20158505-20158527 ATGATGCAGACCTGAAGTCTTGG + Intronic
1145304603 17:21666417-21666439 AAGAAGAAGACTTGGACTATGGG + Intergenic
1146771838 17:35575979-35576001 GAGAATCAGAGTTATAGTCTAGG + Exonic
1147320487 17:39642951-39642973 AAGAGGAGGACTTGTAGGCTAGG + Intronic
1149314266 17:55423502-55423524 AAGAAGCAGACTTTCATTCCAGG - Intergenic
1149570059 17:57665879-57665901 AATAAGCAGACTTGCAGTACTGG - Intronic
1151226179 17:72649886-72649908 AAGAAACAGAGGTGTAGGCTGGG - Intronic
1203169598 17_GL000205v2_random:135684-135706 AAGAAGCAGGCTAGTTGTCCAGG - Intergenic
1155557022 18:27031197-27031219 AAGAAGCAGAATTGAAGTTCAGG - Intronic
1156606729 18:38674946-38674968 ATGCAGCACAATTGTAGTCTGGG + Intergenic
1157680277 18:49600117-49600139 AAGAAGGAGACTTTTTGTATAGG + Intergenic
1157874508 18:51259965-51259987 CAGAAGCAGACTTTGAGACTGGG + Intergenic
1158456890 18:57616129-57616151 AAGAAGCACACTGGTTGGCTGGG + Intronic
1162688010 19:12403845-12403867 AAGAAGAAGACCTGCAGGCTGGG - Intronic
1164415822 19:28045813-28045835 AATAAGCACAGCTGTAGTCTTGG - Intergenic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166816064 19:45546962-45546984 AAGAAGCAGAGTTTTAGGCCAGG - Intronic
1166968904 19:46548833-46548855 AAGGAGCAGGCTTCTAGTCTGGG + Intronic
1167485225 19:49758768-49758790 AAGCAGCAGCCTTCTTGTCTTGG + Intronic
1168308521 19:55449723-55449745 AAGATGCAGACGTGAAGCCTGGG - Intergenic
1168538981 19:57194607-57194629 AAGATGTAGGCTGGTAGTCTAGG + Intronic
925850365 2:8075742-8075764 AAGAAGCAGATGTGGAGGCTTGG - Intergenic
927095520 2:19745206-19745228 AAGAAACAGAGTTGGAGTCAAGG + Intergenic
927317411 2:21701098-21701120 AAGAGGCAGACATATAGACTTGG - Intergenic
927506176 2:23616184-23616206 GAGAGGCAGACTTGGAGTGTGGG - Intronic
929814830 2:45222292-45222314 ATGAAGAAGAAGTGTAGTCTGGG - Intergenic
932196613 2:69789457-69789479 GTGAAGCAGCCTTGTTGTCTGGG + Intronic
932197760 2:69798831-69798853 ATGAAGCAGCCTTGTTGTCTGGG + Intronic
933929305 2:87132096-87132118 AAGAAGCAGACTTGTAGTCTTGG + Intergenic
934000634 2:87707889-87707911 AAGAAGCAGACTTGTAGTCTTGG + Intergenic
935104868 2:100032057-100032079 AACAAGTAGACTTATAGTCTTGG + Intronic
935624205 2:105155781-105155803 AAGAAGCATACTTTTAGCTTGGG + Intergenic
936363635 2:111831285-111831307 AAGAAGCAGACTTGTAGTCTTGG - Exonic
939728670 2:145754628-145754650 AAAAAGCAGACAAATAGTCTTGG - Intergenic
941461024 2:165772215-165772237 AAGAAGCAGAATTGAAATATAGG + Intronic
942917315 2:181326865-181326887 AAGCAGCAGACTTGCAGTTACGG + Intergenic
943317129 2:186403231-186403253 AAGAAGCATAGTTGGAGTCTGGG - Intergenic
943516015 2:188887518-188887540 AGGAAGAAGACTTGTATTCCAGG - Intergenic
944110127 2:196123349-196123371 ATGAAGCAGCCTCGTTGTCTGGG + Intergenic
945805872 2:214489061-214489083 CAGCAGCAGAGTTGGAGTCTTGG + Intronic
946752817 2:222909679-222909701 AAGATTCAGACCTATAGTCTGGG - Intronic
1169156925 20:3339394-3339416 AAGAAACAGACTTTTAATGTGGG + Intronic
1172361828 20:34318086-34318108 TTGAAGCAGCCTTGTTGTCTGGG + Intergenic
1172697834 20:36834585-36834607 TAGTAGTAGACTAGTAGTCTGGG - Intronic
1175704167 20:61163446-61163468 AAGAAACAGACTGCTACTCTGGG - Intergenic
1177343145 21:19831484-19831506 ATTATGCAGTCTTGTAGTCTGGG + Intergenic
1179153862 21:38832649-38832671 AGGAATCAGACTTGTATTTTGGG + Intergenic
1182461768 22:30488530-30488552 AAGAATCAGAGTTCAAGTCTAGG + Intergenic
1183943316 22:41308991-41309013 AAAAAGCAGACTGGGAGTTTAGG - Intronic
1184565366 22:45288669-45288691 AAGGAGCAGGCTTGGAGTCACGG + Intronic
950623241 3:14224769-14224791 AAGAAGCAGACCTTCAGTCACGG - Intergenic
950665197 3:14491146-14491168 AAAAAGCAAACTTCTACTCTAGG + Exonic
950844297 3:15999671-15999693 AAGAAGCAGACTCCTAGACAAGG - Intergenic
951169526 3:19523923-19523945 AAGAATCTGAGTTGTTGTCTAGG + Intronic
951403528 3:22264910-22264932 AAGAAGCAGCCCTCTAATCTGGG + Intronic
955640709 3:61080983-61081005 AAGAAGCAGGCTTGTGAGCTGGG - Intronic
959296504 3:104541778-104541800 AAGACCCAGACTTGTCATCTGGG + Intergenic
959346711 3:105204263-105204285 AAGAAGCAAAATTGGAGTATTGG + Intergenic
961430399 3:126878127-126878149 AAGAAAGAGCCTTGTGGTCTTGG + Intronic
964313061 3:155414629-155414651 AACAAGCAGATTGGAAGTCTTGG + Intronic
964796316 3:160501542-160501564 ATGAAGCAGACTCCTAGTCCTGG - Exonic
965191260 3:165532037-165532059 AAGATGCAGGCTGGGAGTCTAGG + Intergenic
967203187 3:187093648-187093670 AAGTAGAAACCTTGTAGTCTAGG - Intergenic
967760972 3:193226078-193226100 AAGTAGCTGGCTTATAGTCTAGG + Intergenic
968786860 4:2628501-2628523 ATGAAGCACACTTGTGGTCCCGG + Intronic
970782169 4:19750665-19750687 GAGGAGCATACTTTTAGTCTGGG - Intergenic
971783332 4:31067410-31067432 AAGAACCAGTATTTTAGTCTGGG + Intronic
974596794 4:64024080-64024102 ATGAAGCAGCCTCGTTGTCTGGG + Intergenic
974799123 4:66792773-66792795 GAGAAACAGACTTGTTGACTTGG - Intergenic
977215445 4:94277921-94277943 AAGAAGTAGAATTTTATTCTAGG - Intronic
977547607 4:98402535-98402557 AAGAATCATACTTAAAGTCTTGG + Intronic
978357370 4:107891485-107891507 GTGAAGCAGCCTTGTTGTCTGGG + Intronic
979018084 4:115460241-115460263 AAGATGCAGACTGGGAGGCTAGG + Intergenic
980207669 4:129742305-129742327 AAGAAGTTGAGTTGTAGACTTGG + Intergenic
981024017 4:140057764-140057786 AAAAAGCAGACTTGGAGACCTGG - Intronic
984346770 4:178538554-178538576 AAGAAATGGACTTGAAGTCTGGG + Intergenic
984888227 4:184469799-184469821 AAGCAGCAGGCCTGAAGTCTTGG - Intronic
986314964 5:6580965-6580987 AGTCAGCAGACTTGCAGTCTTGG - Intergenic
987549343 5:19358460-19358482 AAAAAGTAGATTTGAAGTCTTGG + Intergenic
989421596 5:41246169-41246191 GAGTAGCAGACTTTTAGACTGGG - Intronic
990029533 5:51240287-51240309 AAGAATCAGAGTTTGAGTCTTGG + Intergenic
993353430 5:86877501-86877523 ATGAAGCAGCATTGTTGTCTGGG - Intergenic
993570952 5:89538321-89538343 AAGAACCAGCCTTGTGATCTTGG - Intergenic
994042874 5:95277337-95277359 AAGAACCAGAATTAAAGTCTAGG + Intronic
994470935 5:100205751-100205773 TAGAAGCAGAATTGTAGTTTTGG + Intergenic
994489648 5:100424651-100424673 CTGAAGCAGCCTTGTTGTCTGGG - Intergenic
995267062 5:110174396-110174418 GAGAAGCAGATTTGTGGTCCAGG + Intergenic
995412605 5:111875754-111875776 GTGAAGCAGCCTTGTTGTCTGGG + Intronic
999914179 5:156239102-156239124 AAGAATCAGATTTGGAGGCTGGG + Intronic
1003459484 6:6317199-6317221 AAGAAAAAGACTCGTAGACTGGG + Intronic
1003677948 6:8224264-8224286 AAGATGTAGACTTGGAGGCTAGG - Intergenic
1005002296 6:21254298-21254320 AAGAAATAGACTTGTGGTCATGG + Intergenic
1005017059 6:21384469-21384491 AACAAACAAACTTGTATTCTGGG - Intergenic
1005463755 6:26092327-26092349 AAGAAGCGGACTTGTAAGATAGG - Intronic
1007814254 6:44509295-44509317 AGGAAACAGACTTGTCATCTGGG + Intergenic
1007942525 6:45795517-45795539 AAGAAGGAGGGCTGTAGTCTGGG + Intergenic
1008070737 6:47096612-47096634 AAGAAGAAGGCTTAGAGTCTGGG + Intergenic
1008487218 6:52049235-52049257 CAGCAGCAGGCTTGTAGCCTAGG - Intronic
1011153350 6:84300244-84300266 AAGATGCAGGCTGGGAGTCTAGG + Intergenic
1014652061 6:124051988-124052010 AAGAAGCAGACTCCTGGACTAGG + Intronic
1015362994 6:132362470-132362492 AAGAACCAGACTGACAGTCTGGG - Intronic
1020624560 7:10561527-10561549 ATGAAGCAGCCTTGTTGTCTGGG + Intergenic
1022772286 7:33486665-33486687 AAGAAGCTGACTTCCAGTTTGGG - Intronic
1026239930 7:68564497-68564519 GACCAGCAGACTTGGAGTCTTGG - Intergenic
1027775536 7:82459993-82460015 AAGAAGAAGAATTGTCTTCTTGG + Intergenic
1028082271 7:86592598-86592620 AAGAAGAAGACTTTTAGTTCTGG + Intergenic
1030704129 7:112673756-112673778 ATGTAGCAGAGTAGTAGTCTAGG + Intergenic
1031315673 7:120255265-120255287 AAGAAAATGACTTGTAGTTTTGG + Intergenic
1032465744 7:132143613-132143635 CAGAAGCAGATTGGTAGGCTGGG + Intronic
1032912720 7:136452161-136452183 AAGAAGCAGACATACAGTCTGGG - Intergenic
1037771754 8:21805225-21805247 AAGAAACAGAATTGTAGACTAGG - Intronic
1040023577 8:42761872-42761894 CAGCAGCAGACTTGGAGACTCGG + Intronic
1040547235 8:48408139-48408161 ATGAAGCAGCCTGGGAGTCTCGG - Intergenic
1040943498 8:52856684-52856706 TTGAAGCAGACTTGTAGTTATGG + Intergenic
1042487705 8:69364886-69364908 AAGCAGCAGATTTGTATTTTAGG + Intergenic
1045134625 8:99202119-99202141 AACAGTCAGAATTGTAGTCTAGG + Intronic
1045434012 8:102141395-102141417 AAGAAGCAGACCAGTAATGTTGG + Intergenic
1045695251 8:104802111-104802133 AAGAAGGAGACTTGGGGTCCAGG + Intronic
1045943779 8:107770926-107770948 AAGAAGCAGAGAAGTAGCCTGGG + Intergenic
1047190131 8:122671465-122671487 AAGAGGAAGACATGGAGTCTGGG + Intergenic
1047953238 8:129953116-129953138 AGGAAACAGACTTGTCTTCTAGG + Intronic
1051028051 9:12637715-12637737 AAGAAACATTCTTTTAGTCTAGG + Intergenic
1052182594 9:25548058-25548080 AAGAATCAGGATTCTAGTCTTGG + Intergenic
1052791364 9:32878168-32878190 GAGAAGCAGACATGTAGTGGTGG - Intergenic
1053491328 9:38506470-38506492 AAGAAGAAAACTTGTAGGCCAGG + Intergenic
1054722672 9:68618710-68618732 AAGAAGAATACATGTGGTCTAGG - Intergenic
1055552891 9:77447342-77447364 AAGAAGCAGTACTGTAGTTTGGG - Intronic
1058042552 9:100319507-100319529 AAAAATAAGACTTGTAGGCTGGG + Intronic
1058784614 9:108374842-108374864 AACAGGAAGACTTGTAGCCTGGG - Intergenic
1186013033 X:5158552-5158574 AACAAGCATATTTGTAGTTTTGG - Intergenic
1186834927 X:13428342-13428364 AATAAACAAACTTCTAGTCTTGG + Intergenic
1188740971 X:33781083-33781105 AAGATGCAGACTGGGAGGCTAGG - Intergenic
1189021447 X:37346020-37346042 AAGAACCAGACTTTTAGAATTGG - Intergenic
1190402786 X:50055555-50055577 AAGGAGCAGACTTATGTTCTGGG - Intronic
1191054424 X:56227636-56227658 AAGAAAAAGACTTGCAGGCTGGG - Intergenic
1193355162 X:80512009-80512031 GTGAAGCAGCCTTGTTGTCTGGG + Intergenic
1194275754 X:91879048-91879070 GAGAGGCAGATTTGTAGTGTCGG - Exonic
1197074127 X:122335277-122335299 AAGATGTAGACTGGGAGTCTAGG + Intergenic
1200592998 Y:5100482-5100504 GAGAGGCAGATTTGTAGTGTCGG - Exonic