ID: 936367325

View in Genome Browser
Species Human (GRCh38)
Location 2:111869870-111869892
Sequence TTGGAGACTCAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1265
Summary {0: 5, 1: 50, 2: 111, 3: 285, 4: 814}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936367325 Original CRISPR TTGGAGACTCAGAAGGAGGA GGG (reversed) Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
902535317 1:17116349-17116371 TTTGCGACTCAGAAGGAGTGAGG + Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903120521 1:21214076-21214098 TGGGAGACTGAGCAGGAGAATGG - Intergenic
903606174 1:24576559-24576581 TGGAAGAGTCACAAGGAGGAAGG + Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904287879 1:29464228-29464250 TTGGAGTCTCTGAAGGAGGCAGG - Intergenic
904333957 1:29785046-29785068 GGGGAGACAGAGAAGGAGGAGGG + Intergenic
904574795 1:31498421-31498443 TGGGAGACTGAGCAGGAGGATGG - Intergenic
905032123 1:34892389-34892411 TGGGAGTTCCAGAAGGAGGAGGG + Intronic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
905338342 1:37260612-37260634 TTGGAGCCCCAGAAGGTTGAGGG + Intergenic
905794355 1:40807274-40807296 CTGGAGAGTCACAAGGCGGAAGG + Intronic
906673918 1:47679500-47679522 TTGGAGACACAGGAAGAGGCAGG - Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
906994254 1:50773315-50773337 CTGCAGACTCAGAAGTGGGATGG - Intronic
907639602 1:56173681-56173703 TTAGAGACCCAGAAAAAGGAGGG - Intergenic
907960361 1:59274148-59274170 TTAGAGACTCAGAAGGCAGGGGG + Intergenic
908771778 1:67603921-67603943 TTGGAGACTCAGAAATGGGGAGG + Intergenic
908775899 1:67639648-67639670 TGAGAGACTAAGAAGGAAGAGGG + Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909872202 1:80755732-80755754 TTGGAGACTCAGGAGGTTGGGGG - Intergenic
910442343 1:87265710-87265732 ATGGGGACTGAGAAGGTGGAAGG + Intergenic
910738487 1:90489193-90489215 TTGGAGACTTGGAGGGAGGAGGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911457797 1:98148905-98148927 TTAGAGACTCAGAAGGGGAAAGG + Intergenic
911674384 1:100642648-100642670 TGGGAGACTGAGCAGGAGAATGG + Intergenic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
911956667 1:104244187-104244209 TCAGAGACTAAGAAGGGGGAGGG + Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912521325 1:110246923-110246945 ATGGAGACTCAGAGGGAGAGAGG - Intronic
912702022 1:111885159-111885181 TTTGTGACTAAGGAGGAGGAAGG + Intronic
913099395 1:115549379-115549401 GTAGAGACACAGAAGGAGGGGGG + Intergenic
913576250 1:120178075-120178097 TTAGAGACTTAGAAGGCGGAGGG - Intergenic
914430137 1:147613216-147613238 TTTGAGACTCAGAGGGAAGTAGG + Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915098202 1:153478987-153479009 CTGGAGACTAGGGAGGAGGAAGG - Intergenic
915434438 1:155893073-155893095 TGGGAGAATGAGAAGGAGTAAGG - Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916299744 1:163260491-163260513 TTACAGACTCAGCAGGGGGAGGG + Intronic
916453244 1:164941860-164941882 TTGGAGACTCTGAAGGGAGGAGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916716073 1:167447812-167447834 TTGGGGACTCAAAGGAAGGAAGG - Intronic
916902779 1:169247640-169247662 TTGGCGACTCAGAAGAGGGAGGG - Intronic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917505317 1:175622192-175622214 TTGGAGACTCTGAATCTGGAAGG + Intronic
918002435 1:180510087-180510109 TTAGAGACTCAGCAGGGGGAGGG - Intergenic
918344921 1:183598750-183598772 TTGAAGACCCAGATAGAGGATGG + Intergenic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919613993 1:199782164-199782186 TTGGAGACTGAGAAGAGGGGGGG + Intergenic
919773668 1:201179305-201179327 TGGGAGAGTCACATGGAGGATGG - Intergenic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920034494 1:203056988-203057010 TTGGGGCATCAGAAGCAGGAAGG + Intronic
920377812 1:205518793-205518815 TGGGTGGCACAGAAGGAGGAAGG - Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
921205994 1:212849299-212849321 TGGGAGACCGAGCAGGAGGATGG - Intergenic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921773752 1:219073096-219073118 TTGGAGACTTGGAAGGTGGAAGG - Intergenic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922504539 1:226118901-226118923 TTGGAGAGCCAGAACAAGGATGG + Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922664387 1:227456188-227456210 TTGGAAATTCTGAAGGAGGATGG - Intergenic
922822322 1:228493140-228493162 CAGGAGGCTGAGAAGGAGGAGGG + Exonic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
922995053 1:229950307-229950329 GTAGAGACTCAGAAGCGGGAGGG - Intergenic
923067409 1:230531513-230531535 TTGGAGACTCAAAGGAAGGGTGG + Intergenic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923427945 1:233890822-233890844 TTGGATACTCAGAAGAAGACAGG + Intergenic
923482286 1:234396881-234396903 TGGGGGACTCAGAATGAGAAGGG + Intronic
923751194 1:236747496-236747518 GTGGAGGCTCAGAAGGGTGAGGG - Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923880903 1:238103176-238103198 TTAGAGACTCAGCAGGGGGAAGG - Intergenic
923944843 1:238873026-238873048 TTGGAGACTCGGTAGGGAGAGGG - Intergenic
924036666 1:239944798-239944820 TTGGAGGCTCAGAAGAAGACAGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924226331 1:241924857-241924879 TTGGATTTTCAGCAGGAGGAGGG + Intergenic
924621992 1:245669971-245669993 TTGGAGACTCCGAAGGGGAAAGG + Intronic
1062947291 10:1471257-1471279 GTGGAGCTTCAGAAGGAGAACGG - Intronic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063518552 10:6720322-6720344 TTGGAGACTAGGAAGGACGAAGG - Intergenic
1063767525 10:9159834-9159856 TTGGAGGCTCAGAAGAAGACAGG + Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064235569 10:13571079-13571101 TTAGAGATTCAGAAGGAAGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065187739 10:23185411-23185433 TTGCAGACTCAGAAGTGGGGTGG + Intergenic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065739580 10:28784768-28784790 ATGCAGACTGAGAAGGAGGCAGG - Intergenic
1065836952 10:29666986-29667008 TTGAAGGCTCTGAAGGAGGTAGG + Intronic
1065943093 10:30582699-30582721 TTGGAGACTTAGAGGAAGGGGGG + Intergenic
1066073469 10:31846822-31846844 TTGGAGTTCCAGAAGGAGAAAGG - Intronic
1066142439 10:32519860-32519882 TTGGAGTGTGAGAAGGAGGTGGG - Intronic
1066233908 10:33467193-33467215 TTTTAGAGTCAGAGGGAGGAGGG + Intergenic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066697271 10:38090632-38090654 TTGAAGTCTCAGAAGCAGGAAGG + Intergenic
1066994790 10:42553583-42553605 TTAGAGACTCAGAAGGGGGCTGG + Intergenic
1066995261 10:42556833-42556855 TTGAAGTCTTAGAAGCAGGAAGG - Intergenic
1067010882 10:42712521-42712543 TTGGAGACTCATAAGCAGGGAGG - Intergenic
1067312627 10:45128652-45128674 TTGGAGACTCATAAGCAAGGAGG + Intergenic
1067324659 10:45255981-45256003 TGGCAGACACAGGAGGAGGATGG + Intergenic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1067760200 10:49039251-49039273 TTGGGGTCTCAGCAGGATGAGGG + Intronic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068297636 10:55094734-55094756 GTAGAGACTGAGAAGGAGAAGGG - Intronic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1069262174 10:66412563-66412585 TGGGAGGCTGAGAAGGAGAATGG - Intronic
1069509590 10:69031886-69031908 TTGTAGACGGAAAAGGAGGAAGG - Intergenic
1069540952 10:69293407-69293429 TTGGAGATACTGGAGGAGGAAGG + Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1070316815 10:75321442-75321464 TGGAAGTCTCAGAAGGAGAAAGG + Intergenic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070410150 10:76132239-76132261 TTGGAGCCCAAGAAGCAGGAAGG + Intronic
1070806003 10:79271075-79271097 TAGGCGGCTCAGAAGGAGGCAGG + Intronic
1071134412 10:82437152-82437174 TTGGAGTACCAGAAGGAGAAGGG - Intronic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071679934 10:87694882-87694904 GAGGAAACTCAGAAGGAGTAGGG + Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075444696 10:122505292-122505314 TACGAGACTGAGGAGGAGGAAGG - Intronic
1075518475 10:123128920-123128942 TTGGAAACTCAGAGAGAGCATGG + Intergenic
1075688622 10:124380481-124380503 TTGGGGAGTCAGGAGGAGCATGG - Intergenic
1075953427 10:126501898-126501920 TCAGAGACTCAGAAAGGGGAGGG + Intronic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076347583 10:129790391-129790413 TTAGAGACTCAGAAGCGGGAGGG + Intergenic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077716539 11:4586934-4586956 TGGGATACCCACAAGGAGGAAGG - Exonic
1077717231 11:4594082-4594104 TGGGATACCCACAAGGAGGAAGG - Exonic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079467799 11:20748563-20748585 TTGGAGACTGAGAAGGCAGAAGG - Intronic
1079812812 11:25016308-25016330 TTACAGACTCAGAAGGGGGAAGG - Intronic
1079879842 11:25913012-25913034 CTGGAGACTCAAAAGTGGGAAGG + Intergenic
1080047543 11:27825149-27825171 TTAGAGACTCAGAAAGGGCAGGG - Intergenic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080697371 11:34614350-34614372 TTGCATACTAAGAATGAGGATGG + Intergenic
1080866238 11:36197805-36197827 TTGGAAGCTAAGCAGGAGGATGG + Intronic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1084096691 11:66915995-66916017 TTGGAGGGTAAGGAGGAGGAAGG - Intronic
1085037046 11:73307116-73307138 TGTGAGACTCAGACGGAGGCAGG + Intergenic
1085998342 11:81949762-81949784 TTGGGGACTCGGAAGGGGAAGGG - Intergenic
1086049252 11:82569328-82569350 ATGGAAGCTCAGAAGGGGGATGG - Intergenic
1086445602 11:86867546-86867568 CTAGGGTCTCAGAAGGAGGATGG - Intronic
1086652048 11:89303776-89303798 TTTGAAACTCAGAAGGTGGAAGG + Intergenic
1086845091 11:91739005-91739027 TTGATGACTCAGAAGCAGGAGGG + Intergenic
1086981117 11:93198240-93198262 TTGGAGAATGCGAAGAAGGACGG + Intergenic
1087087125 11:94231189-94231211 TTTGCCACTCAGCAGGAGGAAGG - Intergenic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1088779945 11:113124206-113124228 CTCTAGACTGAGAAGGAGGAAGG + Intronic
1088793629 11:113248748-113248770 GTGGCGACTCAGAAGGAGAAGGG + Intronic
1089549099 11:119256722-119256744 TTAGAGACTCAGAAGCGGGGAGG - Intronic
1089995581 11:122903974-122903996 TGGAAGAGTAAGAAGGAGGAAGG + Exonic
1090487380 11:127126027-127126049 ATGGAGATTTAGAAGGAGGCTGG - Intergenic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091448381 12:557858-557880 TTGGAGACTAGGAATCAGGAAGG - Intronic
1091681803 12:2532772-2532794 TTTAAGACTCAGAAGGAGACAGG + Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092569987 12:9710847-9710869 TGGGAGAGTCAGAAGGGAGATGG - Intergenic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093628641 12:21382316-21382338 TTAGAGATTCAGAAGCGGGAGGG + Intronic
1093656748 12:21703511-21703533 TTGGAGACTCAGAGGTGGAAGGG - Intronic
1093865102 12:24216680-24216702 TGGGAGACCAAGAAGGAGGGCGG + Intergenic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1094415903 12:30214547-30214569 TTGGAAACTCAGAAGGGTGGTGG - Intergenic
1094484261 12:30911889-30911911 TTGGAGAGTCTCAAGGAGGCTGG - Intergenic
1094591267 12:31823214-31823236 TTGGAGACTCAGGAAAAGGTGGG - Intergenic
1094816512 12:34191756-34191778 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097694373 12:62762459-62762481 TTGGAGGCTCAGAAGAGGCATGG + Intronic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098300740 12:69051867-69051889 TTGGAGACTCAGTGGGAAAAGGG + Intergenic
1098480314 12:70950286-70950308 TTGGAGACTCAGAAGGGATGAGG - Intergenic
1098610631 12:72453096-72453118 TTGGAGGCTCAGAAGAAGACAGG + Intronic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099054687 12:77824473-77824495 TTGGAGCCCTAGAAGGAAGAGGG + Intergenic
1099164156 12:79281519-79281541 CTGGAGACTCAAAAGTGGGAAGG + Intronic
1099344044 12:81475815-81475837 CTGGAGGCTGAGAAGGAGAATGG - Intronic
1099355119 12:81624812-81624834 TCAGAGACTCAGAAGGGGGAGGG + Intronic
1099688203 12:85916570-85916592 TTGGAAACTCCGAGGAAGGAGGG - Intergenic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100292076 12:93225309-93225331 TTGGAGACTAAGAAGAGGGAAGG - Intergenic
1100370157 12:93961772-93961794 TTAAAGATTCAGAAGGAGAAGGG + Intergenic
1100762555 12:97825327-97825349 TTGGAGAATCAGAAGGGAGTGGG - Intergenic
1100779598 12:98009741-98009763 TTGAAAACTCAGAAGAGGGAGGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101411494 12:104472564-104472586 ATGGAGACTCAGAAGGATTTAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101616480 12:106342895-106342917 TTGCAGTATCAGAAGGAAGAGGG + Intronic
1101831750 12:108263277-108263299 TTCCAGACTCAAAAGGAGGAAGG - Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1101972808 12:109328008-109328030 TTTAAAACTCAGAAGAAGGATGG + Intergenic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102724327 12:115045909-115045931 TTGGATACTAAGAATGACGATGG + Intergenic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1103059784 12:117849100-117849122 TTGAGGACTAAGAAGGAGAAAGG + Intronic
1103105680 12:118222761-118222783 TTGGAGACTCAGAAGAGGAAGGG + Intronic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103841603 12:123869706-123869728 GAGGAGCCTGAGAAGGAGGAAGG - Intronic
1104110394 12:125699033-125699055 TAGGAGACCCAGCAGAAGGAAGG + Intergenic
1104177613 12:126348201-126348223 CTGGAGACTCGAAGGGAGGAAGG - Intergenic
1104244449 12:127024313-127024335 TTAGAGACTCTGAAGGAGGAAGG + Intergenic
1104481485 12:129111694-129111716 TGAGAGACTGAGAGGGAGGAAGG - Intronic
1104536616 12:129623432-129623454 TTAGAGACTCAGAAGAGGGGAGG - Intronic
1104584090 12:130033926-130033948 TGAGAGCCTCAGAAGGAAGATGG - Intergenic
1104638354 12:130451569-130451591 TTGGGGGCTCAGGACGAGGATGG + Intronic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1104970975 12:132530570-132530592 GTGGAGACCCAGAAGCAGAAGGG - Intronic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106338386 13:28805505-28805527 TTGGCCACTCAGAAGGTGAATGG - Intergenic
1106572690 13:30941651-30941673 ATGGAGACTCAGAAGCAGAGAGG - Intronic
1106772013 13:32970901-32970923 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
1107709592 13:43138657-43138679 TTGGAGACTCAAGAGAAAGAGGG + Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108252135 13:48577931-48577953 TTTGTGTCTCAGAAGGAGGAAGG - Intergenic
1108404560 13:50086995-50087017 TTGCTGACTCTGAAGGTGGAAGG + Intronic
1108493832 13:51005489-51005511 ATGGAGCCTGAGAAAGAGGAGGG - Intergenic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109448937 13:62483423-62483445 TTGGGGACTAAAAAGAAGGATGG - Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110796944 13:79649952-79649974 TTGGAGACTCGGAAGTAGGGAGG - Intergenic
1110809384 13:79794765-79794787 TTGGTGATTGACAAGGAGGAAGG + Intergenic
1110975612 13:81830252-81830274 TTGGAGACTTGGGGGGAGGATGG + Intergenic
1111164542 13:84441853-84441875 TTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1112302274 13:98240976-98240998 TGGGTGACTCAGGAGAAGGAAGG + Intronic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112713744 13:102160081-102160103 TAGGAGAGTGAGATGGAGGAAGG - Intronic
1112745318 13:102521002-102521024 TTGAAGACTGAGTAGGAGAAAGG + Intergenic
1112746637 13:102534247-102534269 TTGGATACTCAGAAGAGGTACGG - Intergenic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114441177 14:22749331-22749353 TTGCAGAATCAAAAGAAGGAAGG + Intergenic
1114451719 14:22830794-22830816 CTGGAGTCTCATAAGGAGAATGG - Intronic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115371366 14:32618351-32618373 TTGGCGACTCAGAAGCAGGGAGG - Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116073437 14:40080018-40080040 TAGGAGAGTGAGAAAGAGGAGGG - Intergenic
1116342859 14:43748281-43748303 TTGGATACTCAAAAGGGTGAGGG + Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116941760 14:50797926-50797948 TGGGAGACTGAGGAGGAGGAGGG + Intronic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117243940 14:53864658-53864680 TTGAAGACTCAAAGGGAGAAGGG - Intergenic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1117640501 14:57793399-57793421 TTGGAGGCTCAGAAGGTAGAAGG - Intronic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1117903772 14:60563499-60563521 TTTGAGAGTCAGAAGTAGGTTGG - Intergenic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118622886 14:67630409-67630431 TTGTAGCCTCAGCAGCAGGATGG + Intronic
1118918136 14:70125330-70125352 TTGGAGACTCGGAAGGGTGGGGG - Intronic
1119210030 14:72824675-72824697 TGGGAGACTGAGGAGGAGCAGGG - Intronic
1120034517 14:79681235-79681257 ATGAAGGCTCAGCAGGAGGAGGG - Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1120736614 14:88060160-88060182 ATGGAGACAGAGTAGGAGGATGG + Intergenic
1120763155 14:88304074-88304096 TGGGAGAGTGAGAAGGGGGATGG + Intronic
1121485086 14:94308546-94308568 ATGCAGACTCAGAAGCAGGGGGG - Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122328350 14:100896383-100896405 ATGGAGACTGAGCAGGACGAGGG + Intergenic
1122638026 14:103139229-103139251 CAGGAGACTCCGCAGGAGGAAGG + Intergenic
1123726176 15:23103702-23103724 TAGGATACTTAGAAGTAGGATGG + Intergenic
1123805172 15:23863337-23863359 ATGGAGGCTCAGAAGCAGAAAGG + Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124216451 15:27811348-27811370 TTGGAGATTCAGAATGGGAAGGG + Intronic
1124814617 15:32976913-32976935 TTGCAGAGTCACAAGGATGAAGG - Intronic
1125552973 15:40561534-40561556 TTGGAGATTCAGAAGTGGGGAGG + Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126367636 15:47912404-47912426 TGGGAGACTGAGAGGGAGGTTGG + Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1126715864 15:51516795-51516817 TTAGAGACTCAGAAGAGGGAGGG - Intronic
1126753413 15:51900357-51900379 TTGGCGACTCAGGATGGGGATGG + Intronic
1127239187 15:57092517-57092539 TTTGAGACAGAGAAGGAGAAAGG - Intronic
1127449526 15:59103277-59103299 TTAGAGACTCAGAAGAGGGAGGG - Intergenic
1127714545 15:61636719-61636741 TTGGGGACTCAGAAGGGAGGTGG + Intergenic
1127823350 15:62680736-62680758 TTAGAGACTCAGAAGGGAAAGGG - Intronic
1127854340 15:62942413-62942435 TTGGAGGTTAGGAAGGAGGATGG - Intergenic
1128691618 15:69728440-69728462 TTGAAGACTCAGAAGCAGGGAGG - Intergenic
1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG + Intergenic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130960421 15:88655244-88655266 TAGGAGACTCAGCAGGTGGCTGG - Intronic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1131476358 15:92743551-92743573 TTGGAGAGTCTGAAGGAAGGAGG + Intronic
1131572089 15:93548780-93548802 TTGGAGACTCAGAAGGGTACAGG + Intergenic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1132042745 15:98538652-98538674 TTGGAGAACTAGAAGGAGCAAGG - Intergenic
1132345649 15:101107199-101107221 TTGGAGACTCAAAACAATGATGG + Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133235851 16:4387108-4387130 TTGAAGTTTCAGAAGGCGGATGG + Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133578486 16:7118412-7118434 TCAGAGACTCAGAAGGAGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133712036 16:8410780-8410802 TTGGAGACTCAGAAGCAGAGAGG + Intergenic
1133911460 16:10070001-10070023 TTAGAGAAACAGAAGTAGGAGGG - Intronic
1134167450 16:11941773-11941795 TGGGAGACTGAGATGGGGGAGGG - Intronic
1134380914 16:13725097-13725119 TTGGAGACTCAGAAATGGGGAGG + Intergenic
1134681054 16:16125894-16125916 TCAGAGACTGAGAAGGAGGTAGG + Exonic
1134712775 16:16336180-16336202 TGGGGGACTGAGAAGGGGGAGGG + Intergenic
1134747348 16:16598543-16598565 TTGGGGAGTCAGAAGCAGGAAGG + Intergenic
1134954052 16:18372513-18372535 TGGGGGACTGAGAAGGGGGAGGG - Intergenic
1134998123 16:18755115-18755137 TTGGGGAGTCAGAAGCAGGAAGG - Intergenic
1135059001 16:19255141-19255163 TGGGAGACTCAGGAGCAGGTGGG - Intronic
1135194772 16:20385571-20385593 TTGGAGACTCAGATGCGGGGAGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135312881 16:21419425-21419447 TGGGAGACTGAGATGGGGGAGGG - Intronic
1135365804 16:21851705-21851727 TGGGAGACTGAGATGGGGGAGGG - Intronic
1135446010 16:22519457-22519479 TGGGAGACTGAGATGGGGGAGGG + Intronic
1135704277 16:24661236-24661258 TGAGAGACTCAGAAGGGGAAGGG - Intergenic
1135948590 16:26889844-26889866 TTCCAGACTCAGAAAGAGGAGGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136152038 16:28357156-28357178 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136168291 16:28471024-28471046 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136194710 16:28644027-28644049 TGGGAGACTGAGATGGGGGAGGG + Intronic
1136211042 16:28758126-28758148 TGGGAGACTGAGATGGGGGAGGG + Intronic
1136255763 16:29038084-29038106 TGGGAGACTGAGATGGGGGAGGG + Intergenic
1136309547 16:29398152-29398174 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136322994 16:29499933-29499955 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136437678 16:30239901-30239923 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136651103 16:31672076-31672098 TTAGAGACTTAGAAGGGGGAGGG - Intergenic
1136732527 16:32429986-32430008 TTGGGATCTCAGAAGGAGGTTGG - Intergenic
1137364491 16:47848994-47849016 TTTGAGGCTCAGCAGTAGGAGGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138135128 16:54514855-54514877 CCGGAGACTTAGAAGGTGGATGG - Intergenic
1138215869 16:55204886-55204908 TTGGATACTCGGAAGAACGAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138522350 16:57578059-57578081 TTCCAGACTTAGCAGGAGGATGG + Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1138862997 16:60781861-60781883 TTTGAGGCTCAGAAAGATGACGG - Intergenic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1139023924 16:62789939-62789961 TGAGAGACTCAGAAGGGGGAGGG - Intergenic
1139232953 16:65304239-65304261 TTGGAGTCTTAGATGGAAGAGGG + Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1139316736 16:66078387-66078409 TTGCAGACTCAGAAGAGGGGAGG - Intergenic
1139620848 16:68140951-68140973 TTGTAGACTCAGAAGAGGGTAGG - Intronic
1139766903 16:69238170-69238192 TTGGAGGGAAAGAAGGAGGAGGG + Intronic
1139964151 16:70736347-70736369 TCTGAGACTCAGAATGAGAACGG - Intronic
1140339859 16:74146849-74146871 TGGGAGGCTCAGGAGGAGGAGGG - Intergenic
1140365441 16:74377389-74377411 TGGGAGACTGAGATGGGGGAGGG + Intergenic
1140659629 16:77175435-77175457 TTGGAGACTCGGAAGAAGGTGGG + Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141724392 16:85777559-85777581 TAGGAGGCTGAGCAGGAGGATGG - Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141986396 16:87583007-87583029 TTGGAGGCTCAGGAGGAGGTGGG + Intergenic
1142018508 16:87765598-87765620 GTGGAGACTCAGGAGGGGGCGGG + Intronic
1203020554 16_KI270728v1_random:399616-399638 TTGGGATCTCAGAAGGAGGTTGG + Intergenic
1203038889 16_KI270728v1_random:672774-672796 TTGGGATCTCAGAAGGAGGTTGG + Intergenic
1143588247 17:7862911-7862933 TTGGAGATTTATAAGGGGGAGGG + Intronic
1143642638 17:8207834-8207856 ATGGAGCCTGAGAAGGAGCAGGG + Exonic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1144495134 17:15741159-15741181 TGGCAGACACAGGAGGAGGATGG - Exonic
1144579236 17:16448764-16448786 TTGAGGACACAGGAGGAGGAGGG + Intronic
1144951306 17:18995514-18995536 TTGCAGTCTCAGAAGGTGGAAGG + Intronic
1145123105 17:20278302-20278324 TTGGAGAATTAGAAGCAAGAGGG + Intronic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146460738 17:33044339-33044361 TTGGACACATAGAAGGTGGATGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146799513 17:35807480-35807502 TTGGAGAGACAGAAATAGGAAGG - Intronic
1147173319 17:38634694-38634716 TTGGAGACTAAGAAGCAGAATGG - Intergenic
1147504997 17:41007159-41007181 TTAGAGACTCAAAAAGTGGAGGG + Intergenic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1149174606 17:53854293-53854315 TTGGAGTAACAGAAGGAGAAGGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151019339 17:70595997-70596019 TTAGAGTCTCAGAATGAGGTGGG + Intergenic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1151418320 17:73981246-73981268 TAAGAAACACAGAAGGAGGAAGG + Intergenic
1152332270 17:79680119-79680141 TTCGAGACTCAGAGGCAGGAGGG - Intergenic
1152393757 17:80019038-80019060 TTTGAAACACAGAAGGAGGTGGG - Intronic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1153749492 18:8214096-8214118 TTGGAGACTCGGAGGGGGGCAGG + Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154118680 18:11633782-11633804 TGGGAGACTGAGATGGGGGAGGG - Intergenic
1154214961 18:12408739-12408761 ATGGAGACTCTGAAGGGTGAGGG + Intronic
1154962507 18:21324008-21324030 TTGGAGATTCTGAAGGGAGAAGG + Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156422850 18:36974327-36974349 TTGGAGACTCAGAAGAGTGGAGG - Intronic
1157522877 18:48357276-48357298 TTGGAGGCTGGGAAGGGGGAGGG + Intronic
1158272696 18:55733763-55733785 TTGGAGGGTCAGAAGCAGGAAGG + Intergenic
1158287026 18:55895116-55895138 GAGAAGACTCTGAAGGAGGAAGG + Intergenic
1158294312 18:55977936-55977958 TTGGAGATTCAGAAGGGAGGAGG + Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158667947 18:59449705-59449727 TTGTAGACTTGGAAGGATGAAGG - Intronic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1159550041 18:69885460-69885482 GAGAAGCCTCAGAAGGAGGAAGG + Intronic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1160331894 18:78001281-78001303 TTAGAGACTCAGAAGGGGAAGGG - Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1160929521 19:1563605-1563627 TTGGGGTCTCAGCAGGAGCAGGG + Intronic
1161266613 19:3367251-3367273 TTGGAGGCCCAGGAGGGGGAAGG + Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161530176 19:4784106-4784128 GTGGAGACTCAGAAGCGGGGAGG + Intergenic
1161988513 19:7670591-7670613 TTGGAGACCCCATAGGAGGAAGG - Intergenic
1162964120 19:14148018-14148040 TTGGAGACAGAGAAAGGGGAAGG + Exonic
1163162716 19:15475151-15475173 GTGGAGATTCAGAAGGGTGAGGG + Intronic
1163171247 19:15532746-15532768 TTGGAGTCTCAGAACCAGGCAGG - Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163283938 19:16334455-16334477 TTGTAGAGACAGAAGGAAGAAGG - Intergenic
1163328726 19:16622307-16622329 TTGGCGCCTCATAGGGAGGAGGG - Intronic
1163431121 19:17268403-17268425 TTGGTTACTAAGAAGGAAGAGGG - Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164446399 19:28321267-28321289 GTGGAGATTCAAAAGCAGGAGGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164731051 19:30504577-30504599 TTGGAGAGAGGGAAGGAGGAAGG - Intronic
1164773295 19:30830039-30830061 TTGGATACTCAGAAGGTAGGAGG - Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166520641 19:43477991-43478013 TTGGAGACTCAGTTGGAGTCAGG - Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167192936 19:48004395-48004417 TGGGAGGCTGAGCAGGAGGATGG - Intronic
1167203138 19:48081421-48081443 TCAGAGATTCAGAAAGAGGAGGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168214957 19:54918608-54918630 TCAGAGTCTCAGAAGGGGGAGGG - Intergenic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
1168482986 19:56737076-56737098 TTGGATGCTCAGAGGCAGGATGG + Intergenic
925572799 2:5330045-5330067 TTATTGACTCAGAAGGAGGAGGG - Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926804880 2:16699040-16699062 TTAAAGACTCAGAAGTGGGAGGG + Intergenic
926805919 2:16710879-16710901 TTGGGGACTAAGAAGAAGAATGG + Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
927469939 2:23366158-23366180 TCAGAGGCTCAGAAGGGGGAGGG + Intergenic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
928220427 2:29398691-29398713 CTGGAAACTGGGAAGGAGGAGGG - Intronic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928761110 2:34584081-34584103 TTGGAGACTGAGAAGTGGGAAGG + Intergenic
928943632 2:36752660-36752682 TAGGAGACACTGGAGGAGGAGGG - Intronic
929326464 2:40617576-40617598 TTGGGGGCTCAGGAGGAGGTGGG - Intergenic
929470748 2:42190263-42190285 GGGGGGACTCAGCAGGAGGAGGG - Intronic
929625105 2:43398615-43398637 ATAGAAACTCAGAAGAAGGATGG + Intronic
929648911 2:43657906-43657928 TTGTAGATACAGAAGAAGGAGGG - Intronic
930349695 2:50234805-50234827 TCGGAGATTCAGAAAGAAGAAGG + Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930524527 2:52511060-52511082 ATGGAGACTCAGTAACAGGATGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930554114 2:52873407-52873429 TTGAAGACTCAGAAGAAGAGAGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931485032 2:62682108-62682130 TTTGACATTCAGAAGGAGGCTGG + Intronic
932182221 2:69657494-69657516 TTGGAGAATAAGTAGGATGATGG - Intronic
932875062 2:75442793-75442815 TTGGAGATTCAGAAGTGGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933148446 2:78885470-78885492 TTAGAGACTTGGAAGGGGGAGGG + Intergenic
933173170 2:79146920-79146942 TTGGAGACTCAGGGTGGGGAGGG - Intergenic
933193082 2:79358871-79358893 TCAGAGACTCAGAAGTAGCATGG + Intronic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
933937724 2:87219826-87219848 TTGGAGACTCATTAGAAGGCAGG - Intergenic
934476541 2:94597282-94597304 TTGGAACCTCAGAAGCAGGAGGG + Intronic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
935476811 2:103532331-103532353 TTGGAGATTCAGAAGTGGGGAGG - Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935706301 2:105860476-105860498 TAGGCGTCTCAGAATGAGGAGGG + Intronic
936355415 2:111745947-111745969 TTGGAGACTCATTAGAAGGCAGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
938930626 2:136083644-136083666 TTGGACACTCGGAAGGGGGCTGG - Intergenic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
939106173 2:137951166-137951188 TTGGAGACTCAGAAGTGGAAGGG - Intergenic
939489291 2:142857467-142857489 CTGGAGGCTGAGGAGGAGGATGG + Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939742036 2:145920011-145920033 TTGCAAACTCAGAAGGAAAAGGG + Intergenic
939946431 2:148416774-148416796 TTGGATACTCAGATGAGGGAGGG - Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940733879 2:157427131-157427153 ATAGACACACAGAAGGAGGAAGG + Intronic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
941564634 2:167091298-167091320 TTGGAGTCTCAGAAGTGGCAGGG - Intronic
941586962 2:167371678-167371700 TTGGAAACTGAAAAGGAAGATGG + Intergenic
941622984 2:167799344-167799366 TTGGAGACTTGCAAGGGGGAGGG - Intergenic
941846918 2:170142488-170142510 TTGGAGACCGGGAAGGAGGCAGG - Intergenic
941974398 2:171386998-171387020 TTGGGGAGTCAGAAGGGAGATGG - Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942062272 2:172238861-172238883 TGGTAGACTCAGATGAAGGAAGG + Intergenic
942213474 2:173694892-173694914 TTGGAGACTCGGTGGGAGAAGGG + Intergenic
942430450 2:175905825-175905847 ATGGAGATTCAGAAGCATGAGGG - Intergenic
942981130 2:182083408-182083430 TTGGAGACTCAGAAATGGGCAGG - Intronic
943265258 2:185722669-185722691 TTGGAGACTTAGAAGTAGGGAGG - Intergenic
943322624 2:186464447-186464469 TTAGAGACTCAGAAGTAGGAGGG + Intergenic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
944066473 2:195624537-195624559 TTGTCCACTCAGAAGGAGGGAGG + Intronic
944082401 2:195802859-195802881 GAGGAGACTCAGAAGGGTGAAGG - Intronic
944534878 2:200698880-200698902 TGGGAGAATGAGAAGGATGAAGG + Intergenic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
945200175 2:207273284-207273306 TGGGAGATTCGGAAGGAGGGAGG - Intergenic
945229560 2:207571494-207571516 TTTGAGACTAAGTAGAAGGAAGG + Intronic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946536956 2:220640937-220640959 CTGGAGTCTCTGAAGGAGTAAGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
946906740 2:224424621-224424643 TTTGAGACTGAGAAGGATGGAGG + Intergenic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947131508 2:226931477-226931499 TTTGAGACTCAGAAGGGGAAAGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
948308565 2:236968440-236968462 TGAGAGGGTCAGAAGGAGGAAGG + Intergenic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
948746781 2:240102205-240102227 TTAGAGACTAAGAAAGGGGAGGG + Intergenic
948917520 2:241042897-241042919 CTGGAGTCTGCGAAGGAGGATGG + Intronic
948917542 2:241043065-241043087 TTGGAGTCTGCGAAGGAGGATGG + Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169416576 20:5422345-5422367 TTAGAGACTCAGAAGCTGGAGGG + Intergenic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169766780 20:9155105-9155127 TTACAGACTCAGAAGGGGAAGGG - Intronic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1170313619 20:15018445-15018467 TTGGAGGCTCAGAAGAAGATGGG - Intronic
1170661526 20:18345844-18345866 CCAGAGACTCAGGAGGAGGAAGG + Intergenic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1170834059 20:19868691-19868713 TTGGGGACCCAGAAAGGGGAAGG + Intergenic
1170883810 20:20320786-20320808 TTGTAAACTAAGAAGGAGTAAGG + Intronic
1170961891 20:21032835-21032857 TTGGAGACTCAGAGGTGGGGAGG + Intergenic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171778495 20:29394603-29394625 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822552 20:29867053-29867075 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1172154066 20:32811193-32811215 TGGGGGACTCAGAGGGAGTATGG + Intergenic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173575390 20:44110110-44110132 TTGGAGACTCAGAGCCAGGTAGG - Intergenic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1174857076 20:54056439-54056461 TTGGAGACTCCAAAGAAGGGAGG + Intronic
1175040577 20:56046458-56046480 TTAGAGACTCAGAAGAAAGAGGG + Intergenic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1175787542 20:61721423-61721445 TTAGACACTGAGAAGCAGGAGGG - Intronic
1176097883 20:63352632-63352654 TTTGTGCCTCAGAAGGTGGAGGG - Intronic
1177267710 21:18805880-18805902 TTCGAGTCTCAGAATGGGGAGGG + Intergenic
1177378921 21:20312538-20312560 CTGGAGACTTAGAAGGTGGGAGG + Intergenic
1177832357 21:26153130-26153152 TTAGAGACTCACGAGGAGGAGGG + Intronic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1178755710 21:35347479-35347501 TTGGGGACTCAGAAAGGTGAGGG - Intronic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1179452923 21:41477951-41477973 TTGGGAACTCACAAGGAGGCTGG - Intronic
1179935884 21:44603058-44603080 GTGGAGACAGAGAAGGAGGCTGG + Intronic
1180261792 21:46675242-46675264 TTGGAGGCTCTGAGGCAGGAGGG - Intergenic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1181362923 22:22352762-22352784 CTGCAGACTAAGCAGGAGGAAGG - Intergenic
1181365730 22:22375835-22375857 CTGCAGACTGAGCAGGAGGAAGG - Intergenic
1181382138 22:22514283-22514305 TTGGAGGCACAGCAGAAGGAGGG - Exonic
1181839737 22:25646424-25646446 TTGGAGTTTCAGAAAGAGAAGGG + Intronic
1182208144 22:28649196-28649218 TTGGAGACTCAGGAGGTAGGAGG + Intronic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1183896958 22:40977159-40977181 CTGGAGCCTCAGAACCAGGAGGG + Intergenic
1184208859 22:43023513-43023535 TTGGAGGCTCAGCAGAAGAAGGG - Intergenic
1184450850 22:44582002-44582024 ATGGAGTCTCAGGAGGAGGCTGG - Intergenic
1184968824 22:48000655-48000677 TTGGGGACTCAGGGGAAGGATGG - Intergenic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
949277298 3:2299470-2299492 TTGAAGATTCAGAAGAAAGAGGG - Intronic
949604389 3:5637277-5637299 TGGGAGAATTAGAAGGAGGGAGG + Intergenic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
950572899 3:13813030-13813052 TTAGAGGAACAGAAGGAGGAGGG + Intergenic
950634325 3:14304244-14304266 TTGCAGAGTCACAGGGAGGACGG - Intergenic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951514730 3:23545989-23546011 TTGGAGACTCAGAAGAGAGGAGG + Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952501923 3:33971019-33971041 TTGGAGAGTCAGAGGTAGGTTGG + Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952749202 3:36811533-36811555 TTAGGGACTCAGAAGGTGGAGGG + Intergenic
953028974 3:39163967-39163989 TTGAAGACTCAGAAGTAGGGGGG - Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953563583 3:44013055-44013077 TTGGTGACGGAGGAGGAGGAAGG + Intergenic
953804287 3:46054529-46054551 ATGGACACTCAAAAGGACGAGGG + Intergenic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
953945055 3:47139184-47139206 GTGGAGGCTGAGAGGGAGGAAGG - Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
954804263 3:53206841-53206863 TTGGAATCACTGAAGGAGGAAGG + Intergenic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955241938 3:57186064-57186086 CTGGAGACTCTGGAGGAGCAGGG - Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955629146 3:60953344-60953366 TTCGAGCCTTGGAAGGAGGAAGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956314503 3:67919515-67919537 TTGGAGACTCTGAAAGTGGGAGG - Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
956992366 3:74781889-74781911 TTGAAGACTCAGAAGCTGGGAGG + Intergenic
957291507 3:78282833-78282855 TTGGAGTATCAGAAGGAGACAGG + Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
958811821 3:98868610-98868632 TCGGAGACTCAGAAAGGGGGAGG - Intronic
958859930 3:99434354-99434376 TTGGTGACTCAGAAGGAGAAGGG - Intergenic
958986471 3:100784868-100784890 TTAGAGACCCAGAAGGGGGAGGG + Intronic
959352290 3:105281090-105281112 TTGGAGGCTCAGAAGGATGTGGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960414953 3:117373246-117373268 TTGGATACTCAGAAGGTAGAGGG - Intergenic
960553276 3:119000705-119000727 TTGAAGACTCAAAGGGAGAAGGG + Intronic
960752283 3:120968711-120968733 TTGGATACTCAGAACGGGGGAGG - Intronic
960840883 3:121957436-121957458 TTGGAGTCTCAGAAGGGGATAGG + Intergenic
961495293 3:127287177-127287199 TGGGAGATTGAGAAGGAGCATGG + Intergenic
961955577 3:130799608-130799630 TCAGAGACTCAGAAGGAGGATGG + Intergenic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962417090 3:135192997-135193019 TGGGATCCTCAGGAGGAGGATGG + Intronic
962464375 3:135643005-135643027 TTGGAGTCTCACAATGAGGCGGG + Intergenic
963168667 3:142229952-142229974 TTGGAGACCCAGAAATGGGAGGG + Intergenic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
964022348 3:152028285-152028307 TAGGAGACTCAGAGGGAGAGAGG + Intergenic
964629423 3:158794085-158794107 GTAGAGACTCAGAAGGGTGAAGG - Intronic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
964656106 3:159067521-159067543 TTGGAGTCTTTCAAGGAGGAAGG - Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965653471 3:170958548-170958570 TTAGAGCTTCAGAAGGAGCATGG + Intergenic
965863004 3:173169780-173169802 TTGGAGACCAAGAAAGAGCATGG + Intergenic
966767747 3:183478308-183478330 TAGGAGACAAAGCAGGAGGAGGG - Intergenic
966846488 3:184134727-184134749 TTGAACTCTCAGAAGGATGAAGG - Intergenic
967468068 3:189830791-189830813 TTTGGGACTTTGAAGGAGGAAGG + Intronic
967790523 3:193543941-193543963 TCTGAGACTCAGAAAGAGGCTGG + Intronic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
967954288 3:194865801-194865823 ACTGAGACTCAGAAGTAGGAAGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968124856 3:196151521-196151543 CTAGAGCCTCAGAAGGAGCATGG - Intergenic
968545539 4:1195872-1195894 TGGGAGGCTGAGCAGGAGGATGG - Intronic
968857548 4:3138394-3138416 TTGGAGACTCACAAGGCGGAAGG - Intronic
969121395 4:4913941-4913963 GTGCAGACTGAGCAGGAGGAGGG + Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970234486 4:13944768-13944790 TGGGGGAGTCAGAAGGAAGATGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970576462 4:17433561-17433583 TTAGGCACTCAGAAGGGGGAAGG + Intergenic
970660145 4:18276191-18276213 TTGTGGTCTCAGAAGGAGTATGG + Intergenic
970815377 4:20150094-20150116 GTGGGGACACAAAAGGAGGAAGG - Intergenic
970838382 4:20438135-20438157 TTGGAGAATCATAAGAAGGGAGG - Intronic
971519886 4:27536202-27536224 TTGCAGACTCAGAAGGTGAGAGG - Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971876322 4:32313571-32313593 TTGCAGACACAGAAGGACAATGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972213191 4:36863235-36863257 TTGGAGACTCAGACGGGGAGAGG + Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974272034 4:59662273-59662295 TTGGGGACTCAGAAGAAGACGGG + Intergenic
974490058 4:62553146-62553168 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
974962980 4:68726646-68726668 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975380823 4:73698870-73698892 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
975437445 4:74369307-74369329 TTAGAGACTCAGAAGGGGAAGGG - Intronic
975497856 4:75054327-75054349 ATGGATGTTCAGAAGGAGGATGG - Intergenic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976277553 4:83292845-83292867 TTGGAGACTCAGAAGGGAAGAGG + Exonic
977013470 4:91662697-91662719 TGAGAGATTCAGAAGGAGCAGGG - Intergenic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977814002 4:101392265-101392287 TTAGAGACTCAGAAGTGGGGAGG + Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978002450 4:103573009-103573031 TTTGAGTCTTAGAAGGTGGATGG + Intergenic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
978383564 4:108156838-108156860 GTAGAGACTCAGAAGGGTGAGGG + Intronic
978529330 4:109698409-109698431 TTTGGGAGTCAGAAGGGGGATGG - Intronic
978772485 4:112471407-112471429 TCAGAGACTCAGAAGGCAGAAGG + Intergenic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979086543 4:116417723-116417745 TTGGAGACAGAGTAGGAGGTAGG + Intergenic
979197681 4:117940348-117940370 TTGGAGTATCAGAAGGAGATGGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979325953 4:119379719-119379741 TGGGAGACTCAGAAGTGGGGAGG - Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980378769 4:131982129-131982151 TTGGAGACTCAGATGTGGGGAGG - Intergenic
980548569 4:134302958-134302980 TTGGAGACTCAAAAGCATGGAGG - Intergenic
980747638 4:137040303-137040325 TTGGAAACTCAGAATGGGGGAGG - Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
980963800 4:139501419-139501441 TCAGAGACTCAGAAGGGGGAGGG + Intronic
981176955 4:141692810-141692832 TTGGAGGCTCAGAAGAAGACAGG - Intronic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981442782 4:144801849-144801871 TTGGAGATTCAGAAGAGGGGAGG - Intergenic
981471497 4:145140545-145140567 TTGGAAACTAAAAAGGAGGGAGG + Intronic
981669437 4:147270465-147270487 TTGGGGACTAAGAGGGAAGAGGG - Intergenic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981923287 4:150110639-150110661 TTAGAGACTCAGAAGTGGGGAGG - Intronic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982039455 4:151381337-151381359 TTGGAGACTCAGAAGGGTATAGG + Intergenic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982267369 4:153550853-153550875 TTGGAGACTCAAGATGGGGAAGG + Intronic
982422447 4:155213116-155213138 TTGGAGACTCATAAAGGAGAGGG + Intronic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982448368 4:155521953-155521975 TCGGGGACTAAGAGGGAGGATGG - Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983098720 4:163597981-163598003 TTGGTGTATCTGAAGGAGGAGGG - Intronic
983243812 4:165264376-165264398 TGGGAGACTCAGAAGTGGGGAGG - Intronic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983511144 4:168610706-168610728 TTGGAGAGCCAGAAGGTGGTTGG - Intronic
983881751 4:172940776-172940798 TAGGAGGCTGAGATGGAGGATGG - Intronic
983898523 4:173107108-173107130 TAGGAGACTCAGGAAGAAGAAGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984457774 4:179992727-179992749 TTGGGGACTCAGGACAAGGACGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984699904 4:182812427-182812449 TGGAAGATTCAGAAGAAGGAAGG - Intergenic
985042839 4:185909366-185909388 TTGGAGACTCAGAAGGGCTAGGG + Intronic
985671573 5:1209494-1209516 TTGGAGACTCAGGGAGAGGCTGG - Intronic
985686869 5:1286177-1286199 GTGGAGACTCACGAGGAGGGCGG - Intronic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
986325535 5:6670506-6670528 TTGGAGACTAAGGAGGAGATGGG - Intergenic
986328175 5:6696097-6696119 TTGAAGACTCAGAAGTGGGGAGG - Intergenic
986435845 5:7730038-7730060 ATGGAGACTCCAAAGGGGGAAGG - Intronic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986879008 5:12147283-12147305 TTGAAGACTCAGAAGGGTGGGGG - Intergenic
986943455 5:12985505-12985527 GAGTAGACTGAGAAGGAGGAGGG - Intergenic
987130002 5:14851345-14851367 TTCGGGGCTCAGAAGGAAGATGG + Intronic
987223576 5:15816476-15816498 TTGAAGACTCAGAAGTGGGGAGG + Intronic
987404825 5:17513966-17513988 TTAGAGACTCAGAAGTGGCAGGG - Intergenic
987412432 5:17627691-17627713 TTAGAGACTCAGAAGTGGCAGGG - Intergenic
987492171 5:18595030-18595052 TTGAAGACTGAGAAGAAGGCAGG - Intergenic
987615573 5:20269705-20269727 TTGTAGACTTAGAAGGGTGAAGG + Intronic
988062278 5:26186500-26186522 TTGGAGGCTGAGATAGAGGAAGG - Intergenic
988113599 5:26854874-26854896 TTGGAAACTCAGAAGTAGGGAGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988348539 5:30070644-30070666 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
988880133 5:35493547-35493569 TAGTAGACTGAGGAGGAGGAGGG + Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
989607539 5:43258928-43258950 TTGGAGACTTAGAAGGGGTAGGG - Intronic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990677636 5:58205632-58205654 TGGGAGATTTGGAAGGAGGAAGG - Intergenic
990888826 5:60625699-60625721 TTGGAATCCCTGAAGGAGGAGGG - Intronic
990979296 5:61587340-61587362 TTGGTGACTCAGATGCAAGACGG + Intergenic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991710603 5:69404833-69404855 TTGGAGGCTGAGTGGGAGGATGG + Intronic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992503938 5:77367107-77367129 TTGTAAACTTAGAAAGAGGAGGG + Intronic
992738889 5:79753011-79753033 TTGGAGATTGAGGAGGTGGAAGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993195709 5:84742544-84742566 TTGGAGACTCAAAAGTGGGGAGG - Intergenic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
993705299 5:91162702-91162724 TCAGAGACCCAGAAGAAGGAGGG + Intronic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994313544 5:98305497-98305519 TTGAAGACTCAGAAGTGGGAAGG + Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
995255143 5:110037211-110037233 TCAGAGACCCAGAAGGAGTAAGG - Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
996400688 5:123059035-123059057 TTAAAGACTCAGAAGAGGGAGGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996620413 5:125495036-125495058 TTAGAGACTCAGAAGGGGAAGGG + Intergenic
997069675 5:130606655-130606677 TTGGGTACTTAGAAAGAGGAAGG - Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997162566 5:131624726-131624748 TGGGAGACTGAGAAGGAAAAAGG + Intronic
997475918 5:134142424-134142446 TTTGATCCTCAGAAGTAGGAGGG + Intronic
997636730 5:135414476-135414498 TCGAAGACTCAGAAGCAGGGAGG + Intergenic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999685161 5:154096214-154096236 ATGGTGACTCAGCAGGAGGCAGG - Intronic
999923577 5:156350069-156350091 TTGGAGACTCAGAAGAGGAGAGG + Intronic
999981211 5:156959622-156959644 TTTGAGACTCAGATTGGGGAAGG - Intronic
1000079639 5:157832765-157832787 TTGGATATTCAGTGGGAGGAAGG - Intronic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000441347 5:161267432-161267454 TTGGAGACTCAGAAGTGAGGAGG + Intergenic
1000641073 5:163702265-163702287 TTAGAGACTCAGAAGGGTGAAGG - Intergenic
1000755759 5:165157562-165157584 GTGGAGACTGAGAAGTAGAAGGG - Intergenic
1000821004 5:165983167-165983189 TTGGAGACTCTGAATGGGGGAGG + Intergenic
1000846838 5:166292277-166292299 TGAGGGCCTCAGAAGGAGGAAGG + Intergenic
1001166415 5:169373297-169373319 TTGGAGACTAAGAAGTGGGGAGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001422796 5:171600132-171600154 TTGGAGACTGAGTAGGAGTTTGG - Intergenic
1001760882 5:174207150-174207172 TTGGAAACTCAAAAGGGGGAGGG + Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002050292 5:176566700-176566722 TTCCAGTCACAGAAGGAGGAAGG + Intronic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1002996931 6:2295278-2295300 TTGGAGACTGACAAGGGGGAGGG + Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004673563 6:17820259-17820281 TGGGAGTCTCAGAGGAAGGACGG - Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005088321 6:22029839-22029861 ATGGAGACTGAGAAGGAGAGAGG + Intergenic
1005141328 6:22634881-22634903 TGGAAGACTCAGAAGGGAGAGGG - Intergenic
1005285184 6:24318558-24318580 TTAGAGACTCAGAAGGATGCTGG - Intronic
1005394866 6:25370920-25370942 TTGGTGACTCAGAAGAGGGGAGG - Intronic
1005422816 6:25670484-25670506 TTGGAGAGTCAGATAGATGAAGG + Intronic
1005514022 6:26537642-26537664 TGGAAGACTCAGAAGCAAGAGGG + Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006725245 6:36195528-36195550 TTCTAGAGTCAGAAGGATGAAGG - Intergenic
1006815989 6:36850353-36850375 GTGGAGGCGCAGCAGGAGGAAGG - Intergenic
1006951085 6:37821059-37821081 TTGGAGACATAGAGGCAGGAAGG + Intronic
1007040357 6:38715747-38715769 TCGGAGACTCAGAAGGGGAAGGG + Intronic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009487781 6:64247334-64247356 TCTGAGCCTCACAAGGAGGAAGG + Intronic
1009624394 6:66120542-66120564 TTGGAAACTCAGAAGGGGATAGG - Intergenic
1009806697 6:68608510-68608532 TTGTAGTATCAGATGGAGGAAGG + Intergenic
1009833237 6:68966415-68966437 TGGGTGATTCAGCAGGAGGAGGG - Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010452037 6:76014331-76014353 TTTGAAACTCAGAGGGAGGAAGG + Intronic
1010568991 6:77455002-77455024 TTGGAGATTTAAAATGAGGAGGG + Intergenic
1010828423 6:80501167-80501189 ATAGAGACTCCGAAGGATGAGGG + Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011109527 6:83821705-83821727 TTAGAGTCTCATAAGGAGCACGG + Intergenic
1011113783 6:83867335-83867357 TTGGAGAATTATAAGAAGGAAGG + Intronic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1011553799 6:88554007-88554029 TTGGAGTCTCAGATGCAGGACGG - Intergenic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012164660 6:95933238-95933260 TTAGAGACTCATAAGGGGAAGGG - Intergenic
1012691550 6:102319321-102319343 TTGGAGGCTCAGAAGAAGAAAGG + Intergenic
1012700028 6:102444390-102444412 TTGGAGACTCACAAGGGAGGAGG - Intergenic
1012729698 6:102866682-102866704 TTGGAGACTCAAAAGGGGAAAGG + Intergenic
1012781178 6:103559479-103559501 TTGGACACACAGTAGGAGAAGGG - Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1012830572 6:104199518-104199540 TTGGAAACTCAGGAGGGGGTAGG + Intergenic
1012902344 6:105020708-105020730 ATAGAGACTCAGAAGGGTGAGGG - Intronic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013858448 6:114604544-114604566 TTGGAGTCTCAGAAGTGGGGAGG + Intergenic
1013927966 6:115495289-115495311 TGGAAGACTCAGAAGGAGACAGG - Intergenic
1013954208 6:115821574-115821596 TTAGAGACTCAGAAGAAGAAGGG + Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015499577 6:133918607-133918629 TTGGAGACTCGTAAGGGGAAAGG - Intergenic
1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG + Intronic
1015614810 6:135063663-135063685 TTGGAGGCAGAGAAGGAGAAAGG + Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1015988894 6:138914714-138914736 TTGGAGGCACTGCAGGAGGATGG + Exonic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016172050 6:141030068-141030090 TTGGAGGCTGAGAAGGAGAATGG - Intergenic
1016324060 6:142879772-142879794 TGGGAGGGTCAGAAGGAGGCTGG - Intronic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1016927446 6:149365717-149365739 TTGGAGATTCAGAAGGAAAGGGG - Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017375630 6:153764496-153764518 TTAGAGGCTCAGAAGGAGCAGGG + Intergenic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018402058 6:163433291-163433313 TTGAAGCCTGAGAAGGGGGAAGG + Intronic
1018474895 6:164130513-164130535 TTGGTGACTCCAAAGGTGGAAGG + Intergenic
1018813288 6:167313186-167313208 TTGGGGACCCAGAAGGTGGCTGG - Intronic
1019098861 6:169610880-169610902 TTGGAGACTCACAAGGGGGCAGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021085121 7:16413476-16413498 TTAGAGATTCAGAATGAGAAAGG - Intronic
1021437308 7:20634025-20634047 TTGGAGACTCAGAGGCTGAAAGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021862197 7:24916961-24916983 TTGATGACTTAGAAGAAGGAAGG + Intronic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022029269 7:26477541-26477563 TTGGAGACTGCAGAGGAGGAAGG + Intergenic
1022751417 7:33230577-33230599 TTGCAGACTCAGAAGCAGGCAGG - Intronic
1023868849 7:44252073-44252095 TCCGAGACTCAGACTGAGGAGGG + Intronic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027345497 7:77255406-77255428 TTGGATTATCAGAAGGTGGAAGG - Intronic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1027838132 7:83272713-83272735 TCGGAGACTCAGAAGGGACAGGG - Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028308381 7:89295985-89296007 TTAGAGACTCGGAAGGAGTAGGG + Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028404780 7:90463605-90463627 TTGGAGGCTCAGAAGAAGAGAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029173915 7:98650381-98650403 TTGGAGCATCAGAAGGGAGAAGG + Intergenic
1029669755 7:102021411-102021433 TTGGAGGCTGAGGTGGAGGATGG - Intronic
1029910215 7:104137765-104137787 TTGGGGAGCCCGAAGGAGGATGG - Intronic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030255151 7:107502170-107502192 TTGGAGATTCAGAAGAGGAAGGG - Intronic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030482046 7:110116584-110116606 TTTGAGAGTCTGAAGCAGGAGGG + Intergenic
1030654902 7:112156265-112156287 TTTTAGACTGAGAAGGATGAAGG - Intronic
1030658725 7:112196323-112196345 TTGGTGACAGAGAAGGAGGTAGG - Intronic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031155111 7:118100825-118100847 TTGGAGACACAAAAGGCGGGAGG - Intergenic
1031656608 7:124363917-124363939 TTAGAGACTCATAAGGGGGAGGG - Intergenic
1031674464 7:124591518-124591540 TTAGAGACTCATAAGAAGGAAGG + Intergenic
1031677828 7:124633346-124633368 TGGAAGGCTCAGAAGAAGGAAGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032884617 7:136124366-136124388 TTGGAGGCTCGAAAGGAGGTTGG + Intergenic
1033224880 7:139553598-139553620 TTGGAGGCTCAGAAGAAGACAGG + Intergenic
1033647037 7:143313091-143313113 GTAGAGGCTCAGAAGGAGGGAGG + Intergenic
1033892133 7:146026473-146026495 TTAGAGACTCAGAAGACGGGAGG - Intergenic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1034882543 7:154773604-154773626 TGAGAGACTCAAAAAGAGGAGGG + Intronic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035130501 7:156648261-156648283 TTGGAGTCACACAAGGTGGAGGG + Intronic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035289871 7:157831043-157831065 TTGGTGACTCTGGAGGAAGAGGG + Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036167779 8:6453138-6453160 TGGGAGAGTCAGGAAGAGGAGGG + Intronic
1036278994 8:7382936-7382958 TTAGAGACTCAGAAGGCCGCAGG - Intronic
1036342526 8:7928934-7928956 TTAGAGACTCAGAAGGCCGCAGG + Intronic
1036405151 8:8448147-8448169 TTAAAGACTCAGAAGGCAGAGGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036612505 8:10362558-10362580 TAGGAAACTCAGAAAGGGGATGG - Intronic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036783212 8:11664785-11664807 TTAGAGACTCAGAAGAAAGAGGG - Intergenic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037879469 8:22565878-22565900 TGGGAGACGCGGGAGGAGGAAGG + Intronic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038399622 8:27273117-27273139 ATGGTGTCTCAGAAAGAGGAGGG + Intergenic
1038908017 8:31928854-31928876 TTGGAGACTAAGAAGCGGGGAGG + Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1038976345 8:32700930-32700952 TTGAAGACCCAGAGGCAGGAGGG - Intronic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1039180913 8:34864959-34864981 TTGGAGACCTTGAAGGATGAAGG - Intergenic
1039201661 8:35101341-35101363 TTAGAGCCTCAGAAGGAGGACGG - Intergenic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1039291082 8:36095126-36095148 AGGGGGACTCAGGAGGAGGAAGG + Intergenic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1039550494 8:38439712-38439734 TTGGAGAGAGAGAAGGAGAAAGG - Intronic
1039559376 8:38500354-38500376 TTGGAGACCCAGAAGCAGAGAGG - Intergenic
1039685768 8:39800642-39800664 TTGGAGTATCAGAAGGAGATGGG - Intronic
1039846617 8:41330135-41330157 TTGGAAACTCTGAAAGAGCAAGG + Intergenic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040858093 8:51970768-51970790 TTGTAGACTCAGAAGTGGAAGGG - Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041744988 8:61198722-61198744 TTGGAGACTTAGAAGAAGGGAGG - Intronic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041937351 8:63348477-63348499 TTGGAGACTCAGAAGAGGCAAGG - Intergenic
1042174607 8:66026765-66026787 TGGGAACCTCAGAAGGGGGAAGG + Intronic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042212425 8:66393775-66393797 TTTTAGAGTCAGGAGGAGGAAGG - Intergenic
1042267219 8:66921237-66921259 TTGGAGAATTAGAAGGGGGTGGG + Exonic
1042716359 8:71777340-71777362 TTGGAGACTTGGAAGGTGGGAGG + Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1043074665 8:75683186-75683208 TTGGAGAGTCAGAAGCGGGGAGG - Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043366521 8:79539454-79539476 TTGGAGACTCAGAAGGGTAGTGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1043773115 8:84229681-84229703 TTTGAGATTAAGAAAGAGGATGG + Intronic
1044879529 8:96709252-96709274 TTGGAGACTCAGAAGCGGAGAGG - Intronic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046730569 8:117721263-117721285 TTGGAGACTCAGAAGGGTTGGGG - Intergenic
1046825875 8:118690799-118690821 TTGGAGTCTCAGAAGTGGGGAGG - Intergenic
1046870654 8:119202530-119202552 TTAGAGTCTCAGAAGGAGAAGGG - Intronic
1046873027 8:119224698-119224720 TTGGAGACTCAGGAGTGGGTGGG - Intronic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1046985686 8:120385801-120385823 TTGGCAACTCAGAAGGGTGAAGG - Intronic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047633817 8:126737490-126737512 TTAGAGACTCAGAAGGAGAAGGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048102006 8:131362531-131362553 TTGGAGACTCAGAGGGTGAGTGG + Intergenic
1048129519 8:131678917-131678939 TTCAAGACTCAGTGGGAGGATGG + Intergenic
1048406914 8:134132547-134132569 TTGTAGACTCAGCTGTAGGAAGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048917217 8:139196792-139196814 TTGGAGTCTGTTAAGGAGGATGG - Intergenic
1048921082 8:139230741-139230763 TTGGGGTCACAAAAGGAGGAGGG + Intergenic
1049101102 8:140579712-140579734 ATAGAGACTGAGAAGGAGAACGG + Intronic
1050195411 9:3078037-3078059 TTGGATACTCAAAACGGGGAAGG - Intergenic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052975182 9:34405001-34405023 CTGGAGCCTGAGGAGGAGGATGG + Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053681517 9:40488796-40488818 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1053750139 9:41245072-41245094 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054255638 9:62809411-62809433 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054282196 9:63136138-63136160 TTGGAGCCTCGGAGGCAGGAGGG + Intergenic
1054294608 9:63324313-63324335 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1054335673 9:63806196-63806218 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054392630 9:64628800-64628822 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1054427278 9:65134009-65134031 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1054503098 9:65887531-65887553 TTGGAGCCTCGGAGGCAGGAGGG + Intronic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054749008 9:68885670-68885692 TTGAAGACTTAGAAGAGGGAGGG + Intronic
1054880347 9:70138061-70138083 GTGGAGACTTAGAAGGGTGAGGG - Intronic
1055023742 9:71697124-71697146 TTGCTGACTCAGTAGGATGAGGG + Intronic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1055672070 9:78617824-78617846 TGGGAGATTCAGAGGGTGGAAGG + Intergenic
1055862409 9:80768406-80768428 TCAGAGAGTCAGAAGGAAGACGG + Intergenic
1056113435 9:83419122-83419144 TTAGAGACTCGGAAGGGGAAGGG + Intronic
1056281703 9:85047846-85047868 TTGGATACTCAGAAAGGGGGAGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056593843 9:87988865-87988887 TGGGGGACTCAGAAGAAGAAAGG - Intergenic
1056702914 9:88925683-88925705 TTTGGGACACAGATGGAGGAAGG - Intergenic
1056819924 9:89832831-89832853 TTAGAAACTCAGAAGGGGAAGGG + Intergenic
1057699691 9:97354823-97354845 TTTTGGACTCTGAAGGAGGAGGG - Intronic
1057999731 9:99852742-99852764 TCTAAGACTGAGAAGGAGGAAGG + Intronic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058936121 9:109771308-109771330 TTGGAAAGTTAGAAGAAGGAGGG + Intronic
1059491691 9:114673061-114673083 CTGGACTCTCAGAAGGACGAAGG + Intergenic
1059636923 9:116180130-116180152 TTGGAGTCACAGAATGTGGATGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059828225 9:118058118-118058140 ATGGAGACTCAGAAGCCTGAGGG - Intergenic
1059864823 9:118502616-118502638 TTGGAGATTTAGAAGGCTGAGGG - Intergenic
1060204602 9:121675112-121675134 TTGGCGACTCAGCAGGAAGATGG - Intronic
1060333448 9:122698167-122698189 TTGGAGACTCCGAAGTGGGAAGG + Intergenic
1060383253 9:123197505-123197527 TTAGAGACTCAGAAGAGGCACGG - Intronic
1060426506 9:123511071-123511093 TTTGGGAATCAGAAGAAGGAGGG - Intronic
1060522551 9:124301877-124301899 TGAGACCCTCAGAAGGAGGAGGG - Intronic
1061490601 9:130941905-130941927 TTGGTGAGCCAGAAAGAGGAAGG - Intergenic
1061727718 9:132590482-132590504 ATGGAGACAGAGGAGGAGGAGGG - Intergenic
1203371924 Un_KI270442v1:315169-315191 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1185859566 X:3564982-3565004 TTGGAGACTCCGAAGTGGGAGGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1185943489 X:4347809-4347831 TTGGAGACTGGGAAAGGGGATGG + Intergenic
1185985973 X:4834112-4834134 TCAGAGACTCAGAAGCGGGAGGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186046491 X:5542371-5542393 TTGGAGACTCAGAAAAAGCCTGG - Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186410714 X:9342603-9342625 TGGAAGACTAAGAGGGAGGAGGG - Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187065424 X:15832245-15832267 TTTGAGAGTCTGAAGGATGATGG - Intronic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187424960 X:19168985-19169007 TTTGAGAGTCAGAGGGAAGAGGG - Intergenic
1187435537 X:19265404-19265426 TCAGAGACTCAGAAGGTGGAGGG - Intergenic
1187551766 X:20313123-20313145 TTGGAAACTCAGAAGAGGGGAGG - Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187675276 X:21710387-21710409 TTAGAGCCTCAGAAGGGGAAGGG + Intronic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187834710 X:23420146-23420168 GTGGAGACTCAGAAGTATGGGGG + Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188101032 X:26088163-26088185 TTAGAGATTCAGAAAGGGGAGGG + Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188188771 X:27148250-27148272 TTGGAGACTCAAAAAGTGGGAGG + Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1188780209 X:34273961-34273983 TTGGACACTCAGAAAGGTGAGGG - Intergenic
1188964293 X:36531897-36531919 TTGGAGACTCAGAAAGCGTTGGG - Intergenic
1189167478 X:38874955-38874977 TTGAAGACTCAGAATGGGGGAGG - Intergenic
1189175570 X:38953866-38953888 ATGGAGGCTCAGAAGGATCAAGG + Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189434985 X:40984532-40984554 TTGGAGACTTGGAAGAGGGAGGG + Intergenic
1189607026 X:42689720-42689742 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190681409 X:52830047-52830069 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1190998502 X:55636087-55636109 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1191178398 X:57531987-57532009 TTGGAGACTCAAAAGAAAGGAGG + Intergenic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192884445 X:75321994-75322016 TTGGAGACTGAGAAGGGGTAGGG - Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193405491 X:81096014-81096036 TTGGAGATGCAGAAGGGGTAAGG + Intergenic
1193460316 X:81783798-81783820 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193574170 X:83179058-83179080 TTGGAGAATAATAAGGGGGATGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194047497 X:89026546-89026568 TTGGAGACTCAGAAGAGAGGAGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194089909 X:89572931-89572953 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194280732 X:91950306-91950328 TAGGAGACTCAGAAGAAGAGAGG - Intronic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194597336 X:95874658-95874680 TTAGAGTCTCAGAAGGGAGAGGG + Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1194946506 X:100074663-100074685 TTGGAGAATTGGAAGGGGGAGGG + Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195966715 X:110435596-110435618 TTGGAGACTCAGAAAGAAAGTGG - Intronic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197053375 X:122088259-122088281 GTGGAGTCTCAGAAGGAAAAGGG - Intergenic
1197371661 X:125634289-125634311 TTGTAGACTTAGAAGCAGGAAGG + Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197987602 X:132283612-132283634 TTGGCGTCTCAGAAGGGGGAAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198134421 X:133733273-133733295 TTAGGGACTCAGAAGGGGGAGGG + Intronic
1198178047 X:134174368-134174390 TTGGAGAGACAGAAGAAGGTTGG + Intergenic
1198319684 X:135507590-135507612 TTGGCGACTCAGAAGTGGGGAGG - Intergenic
1198324589 X:135555791-135555813 TGGGAGGCTGAGCAGGAGGATGG - Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198445148 X:136705996-136706018 TTGGAGACTAAGATGCAGAATGG - Intronic
1198518202 X:137428799-137428821 TTCGGGACCCAGAACGAGGAAGG + Intergenic
1198661753 X:138976533-138976555 ATAAAGACTCAGAAGGGGGATGG + Intronic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199119177 X:144030257-144030279 TTACAGACTCATAGGGAGGAGGG + Intergenic
1199242274 X:145561180-145561202 TTGGAGACTTAGAAGGGGAAGGG + Intergenic
1199326733 X:146507430-146507452 TTGGAGAATCAGAAGGGGAGAGG + Intergenic
1199452957 X:147993906-147993928 TGGGAGAATCTGGAGGAGGAGGG - Intronic
1200010001 X:153113745-153113767 TTTGAGAACCAGAAGGGGGAAGG - Intergenic
1200029599 X:153286177-153286199 TTTGAGAACCAGAAGGGGGAAGG + Intergenic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200442560 Y:3228985-3229007 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200598216 Y:5173862-5173884 TAGGAGACTCAGAAGAAGAGAGG - Intronic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1200806212 Y:7436191-7436213 TTGGAGACTCCAAAGTAGGAAGG - Intergenic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic
1201398708 Y:13578624-13578646 TTGGAAACTCAGAATAGGGAAGG + Intergenic
1201695339 Y:16818278-16818300 ATGGGGACTTAGAAGGCGGATGG + Intergenic
1201761461 Y:17543930-17543952 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1201840091 Y:18362060-18362082 ATGGAGACTCAGCAGGGTGAGGG - Intergenic