ID: 936367924

View in Genome Browser
Species Human (GRCh38)
Location 2:111877464-111877486
Sequence TAATTATTAAAACTGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 601
Summary {0: 2, 1: 2, 2: 10, 3: 81, 4: 506}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936367924_936367927 -9 Left 936367924 2:111877464-111877486 CCATCAGCCAGTTTTAATAATTA 0: 2
1: 2
2: 10
3: 81
4: 506
Right 936367927 2:111877478-111877500 TAATAATTATCAAGCTTGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 311
936367924_936367930 27 Left 936367924 2:111877464-111877486 CCATCAGCCAGTTTTAATAATTA 0: 2
1: 2
2: 10
3: 81
4: 506
Right 936367930 2:111877514-111877536 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
936367924_936367929 0 Left 936367924 2:111877464-111877486 CCATCAGCCAGTTTTAATAATTA 0: 2
1: 2
2: 10
3: 81
4: 506
Right 936367929 2:111877487-111877509 TCAAGCTTGGCTGGGCATGATGG 0: 1
1: 2
2: 21
3: 213
4: 2225
936367924_936367928 -8 Left 936367924 2:111877464-111877486 CCATCAGCCAGTTTTAATAATTA 0: 2
1: 2
2: 10
3: 81
4: 506
Right 936367928 2:111877479-111877501 AATAATTATCAAGCTTGGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 345
936367924_936367931 28 Left 936367924 2:111877464-111877486 CCATCAGCCAGTTTTAATAATTA 0: 2
1: 2
2: 10
3: 81
4: 506
Right 936367931 2:111877515-111877537 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936367924 Original CRISPR TAATTATTAAAACTGGCTGA TGG (reversed) Intronic