ID: 936367925

View in Genome Browser
Species Human (GRCh38)
Location 2:111877471-111877493
Sequence AGCTTGATAATTATTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 2, 1: 0, 2: 2, 3: 17, 4: 331}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936367925_936367930 20 Left 936367925 2:111877471-111877493 CCAGTTTTAATAATTATCAAGCT 0: 2
1: 0
2: 2
3: 17
4: 331
Right 936367930 2:111877514-111877536 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
936367925_936367933 24 Left 936367925 2:111877471-111877493 CCAGTTTTAATAATTATCAAGCT 0: 2
1: 0
2: 2
3: 17
4: 331
Right 936367933 2:111877518-111877540 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
936367925_936367935 30 Left 936367925 2:111877471-111877493 CCAGTTTTAATAATTATCAAGCT 0: 2
1: 0
2: 2
3: 17
4: 331
Right 936367935 2:111877524-111877546 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
936367925_936367929 -7 Left 936367925 2:111877471-111877493 CCAGTTTTAATAATTATCAAGCT 0: 2
1: 0
2: 2
3: 17
4: 331
Right 936367929 2:111877487-111877509 TCAAGCTTGGCTGGGCATGATGG 0: 1
1: 2
2: 21
3: 213
4: 2225
936367925_936367931 21 Left 936367925 2:111877471-111877493 CCAGTTTTAATAATTATCAAGCT 0: 2
1: 0
2: 2
3: 17
4: 331
Right 936367931 2:111877515-111877537 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936367925 Original CRISPR AGCTTGATAATTATTAAAAC TGG (reversed) Intronic