ID: 936367929

View in Genome Browser
Species Human (GRCh38)
Location 2:111877487-111877509
Sequence TCAAGCTTGGCTGGGCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2462
Summary {0: 1, 1: 2, 2: 21, 3: 213, 4: 2225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936367925_936367929 -7 Left 936367925 2:111877471-111877493 CCAGTTTTAATAATTATCAAGCT 0: 2
1: 0
2: 2
3: 17
4: 331
Right 936367929 2:111877487-111877509 TCAAGCTTGGCTGGGCATGATGG 0: 1
1: 2
2: 21
3: 213
4: 2225
936367923_936367929 1 Left 936367923 2:111877463-111877485 CCCATCAGCCAGTTTTAATAATT 0: 2
1: 2
2: 10
3: 75
4: 448
Right 936367929 2:111877487-111877509 TCAAGCTTGGCTGGGCATGATGG 0: 1
1: 2
2: 21
3: 213
4: 2225
936367922_936367929 2 Left 936367922 2:111877462-111877484 CCCCATCAGCCAGTTTTAATAAT 0: 1
1: 0
2: 1
3: 27
4: 219
Right 936367929 2:111877487-111877509 TCAAGCTTGGCTGGGCATGATGG 0: 1
1: 2
2: 21
3: 213
4: 2225
936367924_936367929 0 Left 936367924 2:111877464-111877486 CCATCAGCCAGTTTTAATAATTA 0: 2
1: 2
2: 10
3: 81
4: 506
Right 936367929 2:111877487-111877509 TCAAGCTTGGCTGGGCATGATGG 0: 1
1: 2
2: 21
3: 213
4: 2225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936367929 Original CRISPR TCAAGCTTGGCTGGGCATGA TGG Intronic