ID: 936367930

View in Genome Browser
Species Human (GRCh38)
Location 2:111877514-111877536
Sequence CGCCTGTAATCCCAGCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 988408
Summary {0: 121435, 1: 268139, 2: 223994, 3: 153979, 4: 220861}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936367922_936367930 29 Left 936367922 2:111877462-111877484 CCCCATCAGCCAGTTTTAATAAT 0: 1
1: 0
2: 1
3: 27
4: 219
Right 936367930 2:111877514-111877536 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
936367923_936367930 28 Left 936367923 2:111877463-111877485 CCCATCAGCCAGTTTTAATAATT 0: 2
1: 2
2: 10
3: 75
4: 448
Right 936367930 2:111877514-111877536 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
936367924_936367930 27 Left 936367924 2:111877464-111877486 CCATCAGCCAGTTTTAATAATTA 0: 2
1: 2
2: 10
3: 81
4: 506
Right 936367930 2:111877514-111877536 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
936367925_936367930 20 Left 936367925 2:111877471-111877493 CCAGTTTTAATAATTATCAAGCT 0: 2
1: 0
2: 2
3: 17
4: 331
Right 936367930 2:111877514-111877536 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936367930 Original CRISPR CGCCTGTAATCCCAGCACTT TGG Intronic