ID: 936367931

View in Genome Browser
Species Human (GRCh38)
Location 2:111877515-111877537
Sequence GCCTGTAATCCCAGCACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1038702
Summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936367922_936367931 30 Left 936367922 2:111877462-111877484 CCCCATCAGCCAGTTTTAATAAT 0: 1
1: 0
2: 1
3: 27
4: 219
Right 936367931 2:111877515-111877537 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
936367924_936367931 28 Left 936367924 2:111877464-111877486 CCATCAGCCAGTTTTAATAATTA 0: 2
1: 2
2: 10
3: 81
4: 506
Right 936367931 2:111877515-111877537 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
936367923_936367931 29 Left 936367923 2:111877463-111877485 CCCATCAGCCAGTTTTAATAATT 0: 2
1: 2
2: 10
3: 75
4: 448
Right 936367931 2:111877515-111877537 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
936367925_936367931 21 Left 936367925 2:111877471-111877493 CCAGTTTTAATAATTATCAAGCT 0: 2
1: 0
2: 2
3: 17
4: 331
Right 936367931 2:111877515-111877537 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936367931 Original CRISPR GCCTGTAATCCCAGCACTTT GGG Intronic