ID: 936367933

View in Genome Browser
Species Human (GRCh38)
Location 2:111877518-111877540
Sequence TGTAATCCCAGCACTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1035426
Summary {0: 288135, 1: 266162, 2: 155564, 3: 133776, 4: 191789}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936367925_936367933 24 Left 936367925 2:111877471-111877493 CCAGTTTTAATAATTATCAAGCT 0: 2
1: 0
2: 2
3: 17
4: 331
Right 936367933 2:111877518-111877540 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936367933 Original CRISPR TGTAATCCCAGCACTTTGGG AGG Intronic