ID: 936367935

View in Genome Browser
Species Human (GRCh38)
Location 2:111877524-111877546
Sequence CCCAGCACTTTGGGAGGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 888921
Summary {0: 114360, 1: 259489, 2: 214307, 3: 130302, 4: 170463}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936367925_936367935 30 Left 936367925 2:111877471-111877493 CCAGTTTTAATAATTATCAAGCT 0: 2
1: 0
2: 2
3: 17
4: 331
Right 936367935 2:111877524-111877546 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936367935 Original CRISPR CCCAGCACTTTGGGAGGCCG AGG Intronic