ID: 936369357

View in Genome Browser
Species Human (GRCh38)
Location 2:111890655-111890677
Sequence TGTCATTTCCTGGGAATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936369357_936369363 18 Left 936369357 2:111890655-111890677 CCAGCCATTCCCAGGAAATGACA No data
Right 936369363 2:111890696-111890718 TCAGTGTGTTGTACAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936369357 Original CRISPR TGTCATTTCCTGGGAATGGC TGG (reversed) Intergenic
No off target data available for this crispr