ID: 936370644

View in Genome Browser
Species Human (GRCh38)
Location 2:111899202-111899224
Sequence CGCTCTGGCCGGAGTCCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936370635_936370644 2 Left 936370635 2:111899177-111899199 CCACTAGAGTTGCATGGTGGGGC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 936370644 2:111899202-111899224 CGCTCTGGCCGGAGTCCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936370644 Original CRISPR CGCTCTGGCCGGAGTCCCGG GGG Intronic
901408459 1:9066259-9066281 CACTCTGGCTGGAGTCACGCAGG + Intronic
901633939 1:10660997-10661019 TGCTCTGGCCGGGGTCGGGGTGG + Intronic
907440643 1:54476051-54476073 CCCTCTGGCTGGAGTCGCTGGGG + Intergenic
912635248 1:111285857-111285879 CGCTCTGGCAGGAGCTCTGGGGG + Intergenic
916890366 1:169107021-169107043 CGCGCTGGCCGGGGTGGCGGGGG + Intronic
918316622 1:183328053-183328075 CTCTCTGGCCCAAGTCCTGGAGG - Intronic
920616938 1:207502831-207502853 CTCTCTGTCCGGGGTCCCGTGGG + Intronic
922950891 1:229558184-229558206 CGCAGCGGCCGGACTCCCGGAGG - Exonic
1063232293 10:4077104-4077126 CACTCTGGCTGGAGTCCGAGAGG + Intergenic
1063458970 10:6203506-6203528 CGCTGTGGCCCTTGTCCCGGTGG + Intronic
1064086317 10:12349102-12349124 CGCTGTGGCCTGTGGCCCGGGGG - Intergenic
1065342702 10:24722776-24722798 CGCCCCGGCCGGCGTCCCCGAGG + Intronic
1065407674 10:25388326-25388348 CTCTGTGGCCTGAGTCCCTGAGG + Intronic
1065637692 10:27746802-27746824 CGCTCTCGCCGAAGGCCCTGTGG + Intergenic
1069963054 10:72089705-72089727 GGCTCAGGCCGGAGTCTCGTTGG + Intergenic
1072169787 10:92848411-92848433 CGCTCGGGCCGGCGGCGCGGGGG - Intronic
1073063156 10:100744156-100744178 CCCTCTGGCCGGAGCCTGGGCGG - Intronic
1074843375 10:117375803-117375825 GTCTCTGGCCGCAGTCCCCGCGG + Intergenic
1077063506 11:627494-627516 GGCTGCGGCCGGAGTTCCGGAGG + Intergenic
1077211165 11:1371584-1371606 GGCTCTGGCCGTCCTCCCGGGGG + Intergenic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1086345666 11:85893353-85893375 CTCTCTGGCCTGAGTTCTGGTGG + Intronic
1092164813 12:6336340-6336362 CCCTCTGGCCTGAGTCACTGGGG - Intronic
1094652471 12:32391172-32391194 CGCTCTGGCCGCACTCGAGGAGG - Intergenic
1094841141 12:34343153-34343175 CGCTTTGGCCGGCATCCCGCGGG - Intergenic
1096493698 12:52027043-52027065 AGCTCTGGCTGGAATCCCTGTGG - Intronic
1103723698 12:122987707-122987729 CCCTCTGGCCGGGGTGCAGGGGG - Intronic
1105071237 12:133235611-133235633 CGCTAGGGCAGGAGTCCCTGAGG - Exonic
1105535305 13:21259894-21259916 CGCACTTGCCGAAGTCCCTGGGG + Intergenic
1125542691 15:40479482-40479504 GGCTCTGGCGGGAGTCACAGAGG - Intergenic
1129703540 15:77781846-77781868 AGCTCTGGCCGGGGGCCCTGAGG - Intronic
1130224560 15:82046995-82047017 CGCTGTGGCCTGCGTCCCCGCGG - Intergenic
1133046247 16:3089873-3089895 GCCTCCGGTCGGAGTCCCGGCGG + Exonic
1141469862 16:84230900-84230922 TGCTCTGGCTGGAGACCCGGTGG - Intronic
1141756652 16:85995828-85995850 GGCTCATGTCGGAGTCCCGGAGG + Intergenic
1142621160 17:1166478-1166500 CAGTGTGGCCGGAGGCCCGGGGG + Intronic
1143503657 17:7352432-7352454 CGATCTGCCCGGGGTCTCGGAGG + Exonic
1144269131 17:13600901-13600923 CGTCCTGGCCGGAGGCCCGAGGG - Exonic
1145913056 17:28553698-28553720 CAGTCTGGCGGGAGTCCAGGAGG - Exonic
1146119377 17:30177330-30177352 CGCACTGGCTGGAGTGCCAGTGG - Intronic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1152699489 17:81812000-81812022 CGCTCTGGCCTGAGGCAGGGAGG + Intronic
1156337753 18:36186073-36186095 CCCCCTGGCCGGAGACCCAGGGG - Intergenic
1158529686 18:58247775-58247797 GCCTCTGGCTGCAGTCCCGGAGG - Intronic
1160765359 19:805238-805260 CGCTCAGTCCGGAGCCCCGGCGG + Intronic
1160865324 19:1253569-1253591 CCCTGGGGCTGGAGTCCCGGAGG - Intronic
1161069004 19:2251228-2251250 CGCGCTGGCCGGCTTCCCGCAGG + Exonic
1163582339 19:18146106-18146128 CCCTCTGGCCTGAGGCCTGGAGG + Intronic
1163666406 19:18606038-18606060 CGCGCAGCCCGGGGTCCCGGGGG - Intronic
1163678849 19:18669255-18669277 CGGTCAGGCCAGGGTCCCGGGGG - Exonic
1163714680 19:18866779-18866801 CGCCCTGGCCGCAGCCCCGATGG - Exonic
1164159956 19:22620000-22620022 CCCTCTGGCAGTAGTCCCTGAGG + Intergenic
1165768063 19:38362917-38362939 CGCTCAGGCTGGAGTGCCAGTGG + Intronic
929611037 2:43270816-43270838 CACTCTGGCTGGAGTACTGGTGG - Intronic
931431975 2:62215634-62215656 CACTCTTGCCAGACTCCCGGAGG + Intronic
933817379 2:86079240-86079262 CCTTCTGGCTGGAGTCCCAGAGG + Intronic
935046581 2:99489296-99489318 CGCTGTGGCTGGAGTGCGGGTGG + Intronic
936052017 2:109231152-109231174 CGCTCTGGCCTGGCTCCGGGAGG - Intronic
936370644 2:111899202-111899224 CGCTCTGGCCGGAGTCCCGGGGG + Intronic
942277549 2:174334179-174334201 CGCTCTGGCCTCTGACCCGGGGG - Intergenic
944675744 2:202033587-202033609 CGCTCTGGGCGGATTCCTGAGGG - Intergenic
945081033 2:206086015-206086037 GGCTCTCGCCGGAGCCCAGGGGG - Exonic
948912677 2:241012191-241012213 CGCTGTGGCCGAGGTCCCTGGGG - Intronic
1170065919 20:12310611-12310633 CGCTCAGGCTGGAGTGCCAGTGG - Intergenic
1176232295 20:64038643-64038665 CGCCCTGCCCGGCGTCGCGGCGG + Intronic
1183503233 22:38193848-38193870 GACTCTGGCCGGGGTCCCAGTGG - Intronic
1184284839 22:43464709-43464731 AGCTGTGGCCAGAGTCCCAGGGG - Intronic
1185066697 22:48635803-48635825 CGCTCTGGCTTGGGTCCTGGGGG + Intronic
1185317508 22:50185401-50185423 CGCTCTGGGCCGACCCCCGGAGG + Intergenic
956867542 3:73384537-73384559 CACTCTTGCCGGCGTCCAGGGGG + Exonic
963616398 3:147543903-147543925 AGCTCTAGCAGGAGTCCAGGAGG - Intergenic
968756381 4:2418333-2418355 GGCCCTGGCCGGACTCCGGGCGG + Exonic
968835725 4:2963260-2963282 CGCTCCCGCCGGCGCCCCGGAGG + Exonic
987050376 5:14143459-14143481 CGCTCCGGCCGGCGCCCGGGAGG + Intergenic
991416345 5:66396750-66396772 TCCTCTGGCTGGAGTCCAGGGGG + Intergenic
992795960 5:80255640-80255662 CGCTCCACGCGGAGTCCCGGAGG + Intronic
996756731 5:126943849-126943871 CGCTCAGGCTGGAGTGCCAGTGG + Intronic
1003121162 6:3319959-3319981 AGCTCTGGGCTGAGTCCCTGTGG + Intronic
1003256819 6:4482471-4482493 TGCTCTGGCCTGTGTGCCGGCGG - Intergenic
1005825694 6:29630551-29630573 AGCTCTGGACGGAGCCCGGGTGG - Exonic
1006558269 6:34887870-34887892 CGCTGTGCCCGGGGACCCGGGGG - Exonic
1012887284 6:104859952-104859974 CGCCCTGGGCGGAGTCACGTTGG + Intergenic
1013272793 6:108559366-108559388 CGCCCTGCCCGGAGTCAGGGAGG + Intergenic
1018068371 6:160139737-160139759 CGCTCTGGTCGAAATCCCGGGGG + Exonic
1023806691 7:43877627-43877649 CGCTCTGGCCTGAGCCCCTAGGG - Exonic
1026894577 7:74002846-74002868 CGCCCAGGCCGGCGTCCGGGAGG - Intergenic
1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG + Intronic
1029872715 7:103712024-103712046 CTCTCTGGCTTGAGTCCCTGAGG - Intronic
1034479501 7:151308587-151308609 CGCCCTGGCCAGGGTCGCGGAGG + Intergenic
1036296602 8:7542932-7542954 AGCTCAGGCCTGAGTCCTGGAGG + Intergenic
1036325964 8:7778087-7778109 AGCTCAGGCCTGAGTCCTGGAGG - Intergenic
1036955020 8:13178530-13178552 CGCCCAGGCTGGAGTCCCAGTGG - Intronic
1038581245 8:28751052-28751074 AGCCCTGGGCGGAGTCCCCGGGG + Exonic
1050168493 9:2791335-2791357 TGCTCTGGCTGGAGACCAGGTGG + Intronic
1054731375 9:68705419-68705441 CCGTCTGGCCGGAGGACCGGCGG + Intronic
1060886283 9:127154822-127154844 CTCTCTGGCCGGGATCCTGGTGG + Intronic
1062116718 9:134813598-134813620 CCCTCTGGCCTGTGTCCCTGAGG + Intronic
1062138705 9:134943837-134943859 CCCTGTGGCCTGAGTCACGGCGG - Intergenic
1062476262 9:136728849-136728871 CGTCCTGGTCCGAGTCCCGGCGG - Intergenic
1188798291 X:34494038-34494060 CGCCCAGGCTGGAGTGCCGGCGG + Intergenic