ID: 936372148

View in Genome Browser
Species Human (GRCh38)
Location 2:111911122-111911144
Sequence GTTGCCACCCTGAATGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936372144_936372148 23 Left 936372144 2:111911076-111911098 CCAAGCTGCCAGGAAGAGTGGCA 0: 1
1: 0
2: 1
3: 33
4: 316
Right 936372148 2:111911122-111911144 GTTGCCACCCTGAATGAGATTGG 0: 1
1: 0
2: 1
3: 11
4: 129
936372145_936372148 15 Left 936372145 2:111911084-111911106 CCAGGAAGAGTGGCAAGTCAAGT 0: 1
1: 0
2: 3
3: 12
4: 126
Right 936372148 2:111911122-111911144 GTTGCCACCCTGAATGAGATTGG 0: 1
1: 0
2: 1
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936372148 Original CRISPR GTTGCCACCCTGAATGAGAT TGG Intronic
900789915 1:4673061-4673083 GCTGACAACCTGAATGAGCTTGG + Intronic
901183567 1:7357881-7357903 GTCCCCACCTGGAATGAGATAGG + Intronic
903584243 1:24397410-24397432 GTTGCCTCATTGAATGAGTTTGG - Intronic
904887874 1:33755031-33755053 GTTGTAAGCCTGACTGAGATTGG + Intronic
905383037 1:37577786-37577808 GTGCCCACCCTGAATGAGGGAGG - Intronic
907374448 1:54024312-54024334 CTTGCCACCTTAAATTAGATAGG - Intergenic
908394977 1:63717056-63717078 GTTTCCAGCCAGAATGAGCTTGG + Intergenic
909500179 1:76326096-76326118 GTTGCCATCCAGGCTGAGATCGG + Intronic
912249242 1:107993656-107993678 GTTGGCAACCGGAATGAGAGGGG - Intergenic
912438619 1:109680759-109680781 GTATCCACCCTGACTGAGAAGGG - Intronic
912441140 1:109699204-109699226 GTATCCACCCTGACTGAGAAGGG - Intronic
915641917 1:157234351-157234373 GTTTCCACCCTAAATCACATTGG + Intergenic
918924031 1:190756726-190756748 GTGCCCACCCTGACTGAGAATGG - Intergenic
919608665 1:199718147-199718169 GTTGGCACACAGCATGAGATAGG - Intergenic
920442989 1:205993971-205993993 GGTGTCACCCTGAATCAGAAAGG + Intronic
920846107 1:209594256-209594278 GCTGCCAGCCTGAAGGAGACGGG - Intronic
922972229 1:229752344-229752366 GTTGCCATCATAAATTAGATAGG - Intergenic
924013092 1:239688067-239688089 GTTGCCAGCCTGAAAAAAATTGG + Intronic
924294981 1:242577470-242577492 GTTTCAACCCTGAAGGAGAAAGG - Intergenic
1068595448 10:58898179-58898201 GTTTTCACTCTGAGTGAGATGGG + Intergenic
1070594237 10:77821235-77821257 GCTACTACCCTGAAGGAGATGGG - Exonic
1071164878 10:82794188-82794210 GATGCCATTATGAATGAGATAGG - Intronic
1074421755 10:113315200-113315222 GATGCAACCCTGAAGAAGATAGG + Intergenic
1077976843 11:7255396-7255418 GTTTTTACTCTGAATGAGATAGG + Intronic
1079291463 11:19191872-19191894 GTTGCCCCCCTGCCTGACATAGG + Intronic
1079392295 11:20033124-20033146 GTTCCAACACTGAATGACATCGG + Intronic
1083570508 11:63759142-63759164 GTTCCCCCCCAGACTGAGATAGG - Exonic
1087956157 11:104290105-104290127 GTGGACAACCTGAATGAGCTTGG - Intergenic
1088693058 11:112344142-112344164 GTTTCCACCCTAAATGACAGTGG - Intergenic
1094105380 12:26805889-26805911 GTTTCCATTCTGAGTGAGATGGG + Intronic
1100958575 12:99937093-99937115 TTTGCCATCATGAAGGAGATGGG - Intronic
1110559196 13:76892092-76892114 GTAGCCACCCTGAAAGAACTAGG + Intergenic
1111030490 13:82591744-82591766 GGTGCCTCCCTGGCTGAGATGGG + Intergenic
1111110239 13:83698952-83698974 ATTGCCACTCTGAATAAGATGGG - Intergenic
1113267876 13:108639550-108639572 GTCTCAACCCTGAATGACATAGG + Intronic
1114823656 14:26051965-26051987 GCTCCTACCCTGAATGAGATGGG - Intergenic
1115920454 14:38366738-38366760 ATTGCCACCCTAAATAAAATTGG - Intergenic
1117544063 14:56776894-56776916 TTTGCCACCCTAAATGTGCTAGG + Intergenic
1117808601 14:59521154-59521176 GTTCCCACCCAGATTGAGAGTGG - Intronic
1119607545 14:76033670-76033692 GTTTCCAACCTTAATGAGGTAGG - Intronic
1119960456 14:78849807-78849829 GATTCCAGCCTGAATGAGAAAGG + Intronic
1120285697 14:82497958-82497980 GGTACCTCTCTGAATGAGATTGG - Intergenic
1121090956 14:91182357-91182379 GTTGCCAGCCAGAAGCAGATGGG + Intronic
1121148511 14:91607615-91607637 GTTTTCACTCTGAATGAGATCGG + Intronic
1122865577 14:104602533-104602555 GAAGCCTCCCTGAATGAGACAGG - Intronic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1125531750 15:40418177-40418199 GATGCCAAGCTGTATGAGATAGG + Exonic
1126364770 15:47882988-47883010 ATTGCACCCTTGAATGAGATGGG - Intergenic
1127769948 15:62223209-62223231 GTTACCATCCTGCATGAGACAGG - Intergenic
1128588623 15:68874724-68874746 CTTTCCAACCAGAATGAGATGGG - Intronic
1129727975 15:77911288-77911310 GCTGCCTCTCTGAATAAGATGGG + Intergenic
1129839898 15:78737572-78737594 GCTGCCTCTCTGAATAAGATGGG - Intergenic
1130539536 15:84812256-84812278 ATTGCCACGCTGCCTGAGATTGG + Intergenic
1132373305 15:101312223-101312245 GCTCCCACCCTGAATAAGACAGG + Intronic
1137863986 16:51874978-51875000 TTTGTCACCCAGAATGAAATTGG + Intergenic
1138046684 16:53732377-53732399 GTTGCTAACCCGAATGAGAGAGG + Intronic
1140859738 16:79008437-79008459 TTTGCCCCCCTGAGTGAGTTAGG - Intronic
1142310194 16:89307722-89307744 GTCCCCACCTGGAATGAGATAGG + Intronic
1142797520 17:2320158-2320180 GTTTCCACCGTGTATGAGATGGG - Intronic
1149115052 17:53083728-53083750 GTTCTCATACTGAATGAGATGGG - Intergenic
1149399870 17:56285159-56285181 GCTGTCACCCTAAATGACATTGG - Intronic
1150872112 17:68923912-68923934 GTTGTCACACAGAATGAGATAGG + Intronic
1156524807 18:37757029-37757051 ATTGCCTCCCTGAATTAAATTGG + Intergenic
1157629831 18:49083508-49083530 CTGGCCTCCCTGAATGAGCTGGG + Intronic
1165791811 19:38497034-38497056 ATTGCCCCCCAGAATGAGTTTGG - Intronic
1166042675 19:40213167-40213189 TTTGCCAGCCTCAATGAGATGGG + Exonic
1166219636 19:41356124-41356146 GCTTTCACCCTGAGTGAGATGGG + Intronic
1167744936 19:51345221-51345243 GTGGCCAAGCTGAAGGAGATTGG - Exonic
925079689 2:1054132-1054154 ATTGCCACCCTGATTCAGACGGG + Intronic
928544033 2:32312587-32312609 TTTGGCACCCTGAATGTGAAGGG + Exonic
932948256 2:76262564-76262586 GCTGCCCCCCTGAATGAGCTTGG - Intergenic
936372148 2:111911122-111911144 GTTGCCACCCTGAATGAGATTGG + Intronic
941511966 2:166422700-166422722 GATTTTACCCTGAATGAGATGGG + Intronic
944244070 2:197514149-197514171 GTTGCCTCCCTTAGAGAGATGGG - Intronic
944637266 2:201686628-201686650 TCTGCCACCCTGACTGAGATTGG + Intronic
945374813 2:209067709-209067731 GATGCCACCCTGGCTGGGATGGG + Intergenic
946449121 2:219764550-219764572 GTTTTTACCCTAAATGAGATGGG - Intergenic
947017377 2:225636397-225636419 CTTGGCATCCTGAAGGAGATGGG - Intronic
948585904 2:239019362-239019384 GTGGCCACCCTGTAGGAGACAGG - Intergenic
1172522417 20:35576588-35576610 GTTGCCACCCTGAAGGTGACTGG - Intergenic
1173154427 20:40595800-40595822 GTTGCCATCTTGAATGGGAATGG + Intergenic
1174314289 20:49685492-49685514 GTAGCCACCCAGAATGCAATGGG + Intronic
1178448935 21:32674082-32674104 GCTTCCACTCTGAGTGAGATGGG - Intronic
1182317428 22:29457338-29457360 GATCCCACCCTGAAGGATATGGG + Intergenic
951597281 3:24332031-24332053 CTTGCCACCCGGAATGAAAGTGG - Intronic
954309201 3:49751612-49751634 GTTGGCTACCTGAATAAGATTGG - Intronic
960217075 3:115053470-115053492 CTCACCACCCTGAGTGAGATTGG - Intronic
964419485 3:156486450-156486472 ATTGCCACCCTGGTTGGGATGGG + Intronic
968259090 3:197304729-197304751 TTTTCCATCCTAAATGAGATTGG - Intergenic
975839293 4:78456659-78456681 GTTGTCACACTGATTCAGATGGG + Intronic
977762539 4:100756695-100756717 GTGCCCACCCAGAATGAGAGTGG + Intronic
981035974 4:140169268-140169290 GATTTTACCCTGAATGAGATGGG - Intergenic
981494601 4:145377203-145377225 GTTCCCCCCCAGACTGAGATAGG - Intergenic
982761696 4:159292154-159292176 GATTTTACCCTGAATGAGATGGG - Intronic
983152405 4:164300884-164300906 GGTGCCACCCTGAATGAGACTGG - Intronic
985707335 5:1409117-1409139 GATGCCACCCTGGAAGAGAGGGG + Exonic
985798461 5:1984014-1984036 GTTTCCATCTGGAATGAGATTGG - Intergenic
989271522 5:39539147-39539169 GATTTCACTCTGAATGAGATGGG + Intergenic
989605917 5:43244351-43244373 GTTCCCACCTTCACTGAGATGGG + Intronic
990594625 5:57300463-57300485 GTGGCCACCCAGACTGAGAGTGG - Intergenic
994957025 5:106545491-106545513 GCTGCCACACTGACTCAGATAGG + Intergenic
995233790 5:109801498-109801520 GTTGCCATCCTAAATAAAATTGG + Intronic
996167271 5:120240283-120240305 GTTCCCTCCCTGAAGGATATTGG - Intergenic
997660077 5:135582614-135582636 GCTTCCACTCTGCATGAGATCGG - Intergenic
998183762 5:139963406-139963428 GATGCCAACCTGGTTGAGATAGG - Intronic
1001125102 5:169012293-169012315 GATGCCACCTCGAAGGAGATGGG + Intronic
1008139803 6:47818942-47818964 GCTGCAACCCAGAATGAGACAGG - Intronic
1014297476 6:119637763-119637785 GTTTCCCCCCTCAGTGAGATGGG - Intergenic
1024514108 7:50229496-50229518 TTTTCCACCCTGGATGAAATTGG - Intergenic
1027418481 7:77997349-77997371 GCTGACACCGTGAATGAGCTTGG - Intergenic
1028638265 7:93015409-93015431 GTTGCCACCCGGGCTTAGATGGG - Intergenic
1029158570 7:98534803-98534825 GGTTCTACTCTGAATGAGATGGG + Intergenic
1030750167 7:113222905-113222927 CATCCCACCCTTAATGAGATTGG + Intergenic
1033048626 7:137984246-137984268 CTTGCCACCCTGAATAAAATTGG - Intronic
1036033100 8:4993519-4993541 GTTTTCTCCCTGAATGAGTTGGG - Intronic
1038123351 8:24642835-24642857 GTTGCTACCCTGAAGAAGAGTGG - Intergenic
1040818292 8:51531504-51531526 GCTGCTGGCCTGAATGAGATGGG + Intronic
1042387483 8:68194433-68194455 AATGCCAACCTGAATCAGATGGG + Intronic
1044741593 8:95332790-95332812 GTTGCCACCCAGAATGTGTCTGG + Intergenic
1047550937 8:125871582-125871604 GTGCCCACCCAGACTGAGATTGG + Intergenic
1050079522 9:1901631-1901653 GCTGTCACCTTGAATGTGATTGG - Intergenic
1052829336 9:33202389-33202411 GCTGCAACACTGAATGACATTGG - Intergenic
1053276462 9:36787155-36787177 GTTGCTACACTGAGTGACATGGG + Intergenic
1053530394 9:38875546-38875568 GTGGCCACCCTGAACAAGAGTGG - Intergenic
1054202620 9:62099976-62099998 GTGGCCACCCTGAACAAGAGTGG - Intergenic
1054635742 9:67488389-67488411 GTGGCCACCCTGAACAAGAGTGG + Intergenic
1056341249 9:85634522-85634544 GTTTTTACTCTGAATGAGATTGG + Intronic
1057205605 9:93170541-93170563 ATTGTCAGCCAGAATGAGATTGG - Intergenic
1057490313 9:95515695-95515717 GCTGCCACCCTTACAGAGATGGG - Intronic
1060748092 9:126150953-126150975 GTTGCCACCCTTGATCAGAATGG + Intergenic
1186003752 X:5044576-5044598 GGTGCAACCCTAAATGAGCTGGG - Intergenic
1188164119 X:26840347-26840369 GTTGGAACCCTGCCTGAGATTGG + Intergenic
1189976173 X:46462972-46462994 GTTACCACCCTCAGTGAGTTTGG + Intronic
1189982897 X:46528663-46528685 GTTACCACCCTCAGTGAGTTTGG - Intronic
1192360314 X:70434879-70434901 GTAGCCAGCCTGAAAGAGAGGGG - Intergenic
1194511595 X:94802897-94802919 GTTGCCACCTTGAAAGAAAACGG + Intergenic
1197044704 X:121980784-121980806 GTTCCCACCCAGACTGAGAGTGG - Intergenic
1199882749 X:151987746-151987768 GTTTTCACTCTGAATGAGATGGG + Intergenic
1202274645 Y:23103237-23103259 GTGGCCACCCAGAATGAGGGTGG - Intergenic
1202291382 Y:23317449-23317471 GTGGCCACCCAGAATGAGGGTGG + Intergenic
1202427637 Y:24736973-24736995 GTGGCCACCCAGAATGAGGGTGG - Intergenic
1202443154 Y:24933121-24933143 GTGGCCACCCAGAATGAGGGTGG + Intergenic