ID: 936376269

View in Genome Browser
Species Human (GRCh38)
Location 2:111943872-111943894
Sequence CCTTGGCCCCTAAAAACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936376269 Original CRISPR CCTTGGCCCCTAAAAACCCA TGG Intronic
900288643 1:1914477-1914499 CCTTGGCCCCACCAGACCCAGGG + Intergenic
901689402 1:10962867-10962889 CCTTGGCCTCTCAAAGCCCTGGG - Intronic
902644195 1:17786950-17786972 CCTTGGCCTCCCAAAACCCTGGG + Intronic
902689299 1:18099960-18099982 CCGAGGCCCCTGAAAACCTATGG - Intergenic
903775584 1:25791454-25791476 CCCAGGCTCCTCAAAACCCAGGG - Intergenic
904373746 1:30066603-30066625 TCGTGGCTCCTAAAATCCCATGG + Intergenic
904900017 1:33849676-33849698 GCTTGGCCTCTCAAAACCCTGGG - Intronic
906142489 1:43542097-43542119 CCTTGGCCCCCAGAGTCCCAGGG - Intronic
906226326 1:44125352-44125374 CCTTGGACACTAAAAGACCATGG - Intronic
909663985 1:78113637-78113659 CCTTGGCCTCTCAAAACGCTGGG + Intronic
909717572 1:78728050-78728072 CCTGTGCCCATAAAAACCCCAGG + Intergenic
911863063 1:102979399-102979421 CATTGGCACCTGGAAACCCAGGG + Exonic
912448934 1:109758058-109758080 CCTGGGCCCCAAACAACCCATGG + Exonic
913001519 1:114585126-114585148 TCATGGCCCCTTTAAACCCATGG - Exonic
915940763 1:160116799-160116821 CCTGGGCCCAGAAACACCCACGG - Intronic
919978615 1:202628670-202628692 CCATGGCCTCAAAACACCCATGG + Intronic
920304958 1:205012819-205012841 CCTTGGCCCTGAAGACCCCAAGG + Exonic
921574735 1:216821433-216821455 CCTTGGCCCCACAAAGCCCTGGG - Intronic
922042054 1:221906327-221906349 CCTTGGTCCCTAAAAGCACTGGG - Intergenic
1065736047 10:28753444-28753466 CCTTGGCCCCTCAAAGCACTGGG + Intergenic
1065901634 10:30213450-30213472 CCTTATTCCCTATAAACCCAAGG + Intergenic
1066219624 10:33322497-33322519 CCTTGGCCCCCAAAAGCACTGGG + Intronic
1066281641 10:33923633-33923655 CTTGTGCCCATAAAAACCCAAGG + Intergenic
1067061967 10:43082225-43082247 TCTTGGCCCCTGAAAAGCCTGGG + Intronic
1067223811 10:44362785-44362807 CATTGGCCCCAAACAGCCCAAGG + Intergenic
1067348151 10:45453192-45453214 GCTTGGCCTCGAAAAAGCCAAGG - Intergenic
1068136079 10:52952330-52952352 CCTTGGCCCCTGGGAGCCCATGG - Intergenic
1068719961 10:60233685-60233707 CCTTGGCCTCTAAAAATGCTGGG + Intronic
1069125596 10:64628751-64628773 CCTATGCCCATAAAAACCCCAGG + Intergenic
1069135844 10:64764691-64764713 CCTTGGCCTCTCAAAAGCCTGGG - Intergenic
1069732046 10:70623153-70623175 CCAAGGCCCATAAAAGCCCAGGG + Intergenic
1070240336 10:74674004-74674026 CCTGTGCCCATAAAAACCCCAGG - Intronic
1070307370 10:75247804-75247826 CACTGGCTCCTAAAAGCCCAGGG - Intergenic
1070604676 10:77890409-77890431 CCTGGGACCCTAGAGACCCAAGG - Intronic
1071860594 10:89668830-89668852 CCCTGTCCCCTGAATACCCAGGG + Intergenic
1073670305 10:105580086-105580108 CCTTGGCCCCCAAGAATGCAGGG + Intergenic
1073825058 10:107311461-107311483 CCTTGGCCTCTCAAAGCCCTGGG - Intergenic
1075499517 10:122960117-122960139 CCTTGGCCGCCAAAAATTCACGG - Intronic
1077013468 11:390092-390114 CCTTGACCCCTACAATCCCTGGG - Intergenic
1077339239 11:2018645-2018667 CCTTGGCTCCAGAAAACCCAAGG + Intergenic
1081939769 11:46930884-46930906 CCTTGGCCTCTCAAAATCCTGGG + Intergenic
1083626166 11:64073135-64073157 CCGTGGCCCTCAGAAACCCACGG - Intronic
1086286186 11:85253980-85254002 CCTGTGCCCATAAAAACCCAAGG - Intronic
1087407965 11:97752840-97752862 CCTGGGCCCCTGAGAACACAGGG + Intergenic
1087625219 11:100587935-100587957 CATTAGCCCCTAGAAATCCAAGG - Intergenic
1088135676 11:106552785-106552807 CTGAGGCCCATAAAAACCCAGGG + Intergenic
1089569229 11:119392005-119392027 CCTGTTCCCCTAAAAACCTATGG - Intergenic
1089753105 11:120665897-120665919 CCTTGGCTCCTGAAGACCAAGGG - Intronic
1090678882 11:129031807-129031829 CCTGTGCCCATAAAAACCCCAGG + Intronic
1091308508 11:134556442-134556464 CCTTGGCCCCTACAACCTCCTGG - Intergenic
1202822223 11_KI270721v1_random:73827-73849 CCTTGGCTCCAGAAAACCCAAGG + Intergenic
1091617363 12:2059597-2059619 CCTTGCCCCCTATACACACAGGG - Intronic
1094443913 12:30508992-30509014 CATTTGCCAGTAAAAACCCAAGG - Intergenic
1097514451 12:60587079-60587101 CCTAGGACCATAAAAACCCTAGG + Intergenic
1098285614 12:68904128-68904150 CCTTGGCCCCTGAAAGCACTGGG + Intronic
1103838925 12:123846884-123846906 CCTTGTCCCCCCAAATCCCATGG - Intronic
1104596859 12:130126001-130126023 CCATGGCCCCTGAGAACCCCTGG - Intergenic
1106228597 13:27803626-27803648 TCTTGGCCCCCACACACCCAGGG + Intergenic
1106230592 13:27818301-27818323 CCTTGGCCTCTCAAAACTCTGGG + Intergenic
1107875091 13:44783314-44783336 CCTGTGCCCATAAAAACCCCAGG - Intergenic
1108566714 13:51706692-51706714 CCTTGGCCCATAAGACCCCACGG + Intronic
1110789014 13:79566974-79566996 CCTTGGCCTCTCAAAGCCCTGGG - Intergenic
1111104689 13:83629787-83629809 CCTGTGCCCATAAAAACCCCAGG - Intergenic
1111168261 13:84491509-84491531 CCTGTGCCCATAAAAACCCCAGG + Intergenic
1113421193 13:110172729-110172751 CTTTGGCCCCTGGAAACCCTGGG + Exonic
1116232806 14:42239413-42239435 CGTTGGTCTCTCAAAACCCAAGG - Intergenic
1116872633 14:50082809-50082831 CCTTGGCCCCTAAAAGTGCTGGG + Intergenic
1118012395 14:61623125-61623147 CCTTGGCCTCCAAAAGCCCTGGG - Intronic
1118588875 14:67385338-67385360 CCTTGGCCCCTTAAGTGCCAGGG - Exonic
1119075925 14:71639154-71639176 CCTTGGCCTCTCAAAACGCTAGG - Intronic
1119863303 14:77952836-77952858 CCTTGGCCTCCCAAAACCCTGGG - Intergenic
1119890799 14:78180731-78180753 CCTGGGCCCCATAAATCCCAGGG + Intergenic
1120492000 14:85190141-85190163 GATAGGCCCCTAAAACCCCAGGG + Intergenic
1120998932 14:90437457-90437479 CCTGGGCCCCCAAAGACACATGG + Intergenic
1121417065 14:93787103-93787125 CCTGGGTCCCTTAAATCCCAGGG - Intronic
1122449532 14:101794011-101794033 CCTGTGCCCATAAAAACCCCAGG - Intronic
1122766723 14:104077201-104077223 CCTTGGCCCCCAAAAATGCTGGG + Intergenic
1122871365 14:104640526-104640548 CCTTGGCTCCTACACACCCCTGG + Intergenic
1122939666 14:104975627-104975649 CTCTGGCCCCTAAGAGCCCAGGG + Intronic
1124494230 15:30176590-30176612 CCATGGCCTCAAAACACCCATGG + Intergenic
1124510510 15:30320313-30320335 CATGTCCCCCTAAAAACCCAGGG - Intergenic
1124650974 15:31473773-31473795 CCATGGCCACTACATACCCATGG - Intergenic
1124732378 15:32210214-32210236 CATGTCCCCCTAAAAACCCAGGG + Intergenic
1124749340 15:32362055-32362077 CCATGGCCTCAAAACACCCATGG - Intergenic
1127113119 15:55696022-55696044 CCTTGGCCCCCAAAAGCATAGGG - Intronic
1128755125 15:70178143-70178165 CCTTGGCCTCTAAAAGTCCTGGG + Intergenic
1129627027 15:77212246-77212268 CCTTGGCCACTAAAAAACCTGGG - Intronic
1130420780 15:83745048-83745070 CCTGGACCCCTAAAAACCCCAGG + Intronic
1130428871 15:83826371-83826393 CCTTGGCCCCTCACAACACTGGG + Intronic
1132251410 15:100338247-100338269 CCATGGCCCCTAAACAGCTACGG + Intronic
1133864101 16:9625830-9625852 CCTTGGCCTCCCAAAACCCTGGG + Intergenic
1134685751 16:16157000-16157022 CCTTGTCCCCTAAAAAGCAGTGG - Intronic
1135266734 16:21033080-21033102 CCTTGGCCCCTCAAAATGCCGGG + Intronic
1135404681 16:22189852-22189874 CCTTGGTCCCTAAGAAGCAAAGG - Intronic
1135734790 16:24922170-24922192 TCTTGGCCCCCAAAAACAGAAGG + Intronic
1135792015 16:25405678-25405700 CCTTGGCCTCCCAAAACCCTGGG - Intergenic
1140544282 16:75791337-75791359 CCTTGGCCTCTAGAAGCCCATGG + Intergenic
1141997936 16:87647120-87647142 CCTGGGCCCCCCAAAACCCCAGG - Intronic
1143048635 17:4103665-4103687 CCTTGGCCTCTTAAAATCCTGGG - Intronic
1143134032 17:4700672-4700694 CCTTGGCCCCCCAAAATCCTGGG - Intronic
1145946054 17:28775499-28775521 CCCTAGCCCCCAAAAACCCAGGG + Intronic
1146771559 17:35572933-35572955 CCTTGGCCTCCCAAAACCCTGGG - Intergenic
1148396104 17:47309301-47309323 CCTTGGCCCCTAAAAGTGCTGGG + Intronic
1152373740 17:79906844-79906866 CCTTGGCCCCTCAAAATGCTGGG + Intergenic
1152553103 17:81039638-81039660 CGGTGGCCCCTGAAAGCCCAGGG - Intronic
1153286953 18:3465461-3465483 CCTTGGCCTCTCAAAGCCCTGGG - Intergenic
1153364671 18:4242220-4242242 CTTTGTCCCCTAAAAAGCCTGGG - Intronic
1153471337 18:5449766-5449788 CCTTGGAACGTAAAATCCCATGG - Intronic
1153584240 18:6604832-6604854 CCTTGGCCTCTCAAAACACTTGG - Intergenic
1157139911 18:45095330-45095352 CTTTGGCCCCTAGAAATCCAAGG + Intergenic
1158607635 18:58909988-58910010 CCTTGGCCTCCCAAAACACAGGG - Intronic
1159006988 18:63022292-63022314 CCTGGGCCTCTGCAAACCCATGG + Intergenic
1160281638 18:77496137-77496159 CCTTGTCCCCTCTCAACCCAGGG + Intergenic
1160826815 19:1084067-1084089 CCGCAGCCCCTAAACACCCAGGG - Intronic
1161435637 19:4261142-4261164 CCTTGGCCTCTAAAGGCACAGGG + Intronic
1162846418 19:13396158-13396180 CCTTGGCCACTACAAAACCAAGG + Intronic
1163702797 19:18794741-18794763 CCTCGGCCTCTCAAAACCCTGGG + Intergenic
1164063371 19:21694134-21694156 CCTTGGCCCCCGGGAACCCATGG - Intergenic
1165300825 19:34967669-34967691 CCTATGCCCATAAAAACCCCAGG + Intergenic
1165651676 19:37496492-37496514 CCTTGGCCCCCTAAAACGCTGGG + Intergenic
1165774699 19:38397644-38397666 CATAGGCCCCTAAAACCCCAAGG + Intergenic
1165937509 19:39398244-39398266 CCTTAGCCCCAGATAACCCAGGG - Exonic
1165969605 19:39615603-39615625 CCTTGGCCTCCAAAAGCCCTGGG + Intergenic
1166271137 19:41714851-41714873 CCTGAGCCCTTAAAAACCCACGG - Intronic
1166986415 19:46662284-46662306 CCTTGGCTCCCTAAAAGCCAAGG + Intergenic
1168266783 19:55227755-55227777 CCTTGGCCTCCAAAGCCCCATGG + Intronic
926042911 2:9689428-9689450 CCTTGGCCTCTCAAAACACTGGG + Intergenic
927511756 2:23648400-23648422 CCTGGGCCCCTAAAAGGCCACGG - Intronic
931650722 2:64466434-64466456 CCTTGGCCCCTCAAAGCTCTGGG - Intergenic
932191364 2:69743524-69743546 CCCTGGCAACTAAAAACCTAGGG - Intronic
932556526 2:72829651-72829673 CCTGTGCCCATAAAAACCCCAGG + Intergenic
933466427 2:82658005-82658027 CCTGTGCCCATAAAAACCCAAGG + Intergenic
934479628 2:94623164-94623186 CCCTGCCCCCGAAATACCCATGG + Intergenic
935513051 2:104000191-104000213 CCTTGGCCTCTCAAAATCCTGGG - Intergenic
936059626 2:109285946-109285968 CCATGGACCCTCAGAACCCAGGG - Intronic
936376269 2:111943872-111943894 CCTTGGCCCCTAAAAACCCATGG + Intronic
937173934 2:119907347-119907369 CCTTGGCCTCCAAAAACGCTAGG - Intronic
937924723 2:127158787-127158809 CCATGGCCCCTAAGTCCCCATGG - Intergenic
938942495 2:136181307-136181329 CCTGTGCCCATAAAAACCCCAGG - Intergenic
939017739 2:136920987-136921009 CCTGGGCCCCTGAGAGCCCAGGG + Intronic
939374448 2:141345753-141345775 CCTTGGCCTCCCAAAACCCTGGG + Intronic
942344075 2:174983415-174983437 CCATGGGCCAAAAAAACCCAGGG + Intronic
944615527 2:201455461-201455483 CCTTGGCCCCTAAAAATGCTGGG - Intronic
946471386 2:219964249-219964271 CCTATGCCCATAAAAACCCCAGG + Intergenic
947874931 2:233461645-233461667 CCCTGTCCCCTCAAAGCCCATGG + Intronic
948306269 2:236949254-236949276 CCAAGGCCCCTACAAGCCCAAGG + Intergenic
948850478 2:240703049-240703071 CCTTGGCTCCCCGAAACCCAGGG + Intergenic
948870908 2:240797592-240797614 CCATGGCCCCCAGCAACCCATGG + Intronic
1169523601 20:6399596-6399618 CCTTGGCCTCCCAAAACACAGGG - Intergenic
1170712901 20:18808155-18808177 CCTTGGCCTCCCAAAGCCCAGGG + Intergenic
1171132336 20:22665317-22665339 CCCTGGCCCCCCAAAACTCATGG + Intergenic
1173202083 20:40961589-40961611 CGTTGGCCTCTTAACACCCAGGG - Intergenic
1173824605 20:46040116-46040138 CCTTGGCCTCTCAAAACACTGGG + Intronic
1174884291 20:54315137-54315159 CCTTTGCCCCTAAAAATCTCAGG + Intergenic
1175386845 20:58602225-58602247 CCTTGGCCCCCAGAAACCACTGG + Intergenic
1175598229 20:60252639-60252661 CCTTGGCCCCTCAGAACAAAGGG - Intergenic
1177555082 21:22678839-22678861 CCTTTGCCTATAAAAACCCCAGG + Intergenic
1178447338 21:32658239-32658261 CCTGTGCCCATAAAAACCCCAGG + Intronic
1179033622 21:37741510-37741532 CCTTGGCCCCTTTAGACTCAGGG + Intronic
1179131890 21:38644904-38644926 CCTTGGCCCCTCAAAATGCTAGG - Intronic
1179293559 21:40041135-40041157 CCTTGTCCCATAAAACCCAAGGG + Intronic
1179659915 21:42867813-42867835 CCTTGGCCCCTCAAAATGCTGGG + Intronic
1179823313 21:43949868-43949890 CCTTGGCTCCTGAACACACAAGG + Intronic
1179984881 21:44914670-44914692 CCTTGGCCTCTCAAAACACTGGG - Intronic
1180617191 22:17136113-17136135 CCTTGGCCCCTCAAAGCGCTGGG - Intergenic
1180617241 22:17136427-17136449 CCTTGGCCCCTCAAAGCGCTGGG - Intergenic
1181485834 22:23231255-23231277 CCTTGGCCTCTCAAAACACTGGG - Intronic
1181685036 22:24522439-24522461 CCATGGACTCTAGAAACCCAGGG - Intronic
1183316013 22:37137293-37137315 CCCTGGCCTCTGAAAGCCCATGG + Intronic
950510987 3:13426743-13426765 CCTTGGCCTCTAAAATCACTGGG - Intergenic
950999587 3:17542466-17542488 CCTTGGCCCCCAAAAGCACTGGG + Intronic
953883666 3:46704151-46704173 CCGTGTCCCCTAGACACCCAGGG + Intronic
953883698 3:46704257-46704279 CCATGTCCCCTAGACACCCAGGG + Intronic
953883751 3:46704447-46704469 CCATGTCCCCTAGACACCCAGGG + Intronic
953883802 3:46704612-46704634 CCATGTCCCCTAGACACCCAGGG + Intronic
953883811 3:46704639-46704661 CCATGTCCCCTAGACACCCAGGG + Intronic
953883834 3:46704721-46704743 CCATGTCCCCTAGACACCCAGGG + Intronic
953883843 3:46704749-46704771 CCATGTCCCCTAGACACCCAGGG + Intronic
953883868 3:46704831-46704853 CCATGTCCCCTAGACACCCAGGG + Intronic
953883877 3:46704858-46704880 CCATGTCCCCTAGACACCCAGGG + Intronic
954672278 3:52297498-52297520 CCCTGCCCCCTAGAAACCCCCGG - Intergenic
954716443 3:52529114-52529136 CCTTGCCACCAACAAACCCAGGG - Intronic
954836686 3:53475508-53475530 CCTTGGCCTCTGAAAACTCTGGG + Intergenic
955065813 3:55532993-55533015 CCTTGGCCCCTAAAATCCTGGGG + Intronic
955878973 3:63523505-63523527 CCTTTGCCCCTAATCACCAAAGG + Intronic
956163035 3:66374632-66374654 CCTTGGCCCCCCAAAATCCTGGG - Intronic
957414161 3:79878878-79878900 CCTGTGCCCATAAAAACCCCAGG - Intergenic
958466796 3:94469864-94469886 CCTGTGCCCATAAAAACCCCAGG - Intergenic
958467359 3:94473888-94473910 CCTGTGCCCATAAAAACCCCAGG - Intergenic
958551805 3:95623260-95623282 CTTTGGCCTCTGAAAACACAGGG + Intergenic
959063520 3:101636070-101636092 TCTTGGCCCCTGAGAGCCCATGG + Intergenic
960420970 3:117444814-117444836 CCTGTGCCCATAAAAACCCCAGG - Intergenic
961635444 3:128330034-128330056 CCTTACCCCCTAAAAAGCCCAGG + Intronic
961769585 3:129239267-129239289 CCTTGGCCCCTGAAAATGCTGGG - Intergenic
962273107 3:133992613-133992635 CCTGAGCCCATAAAAACCCCAGG + Intronic
962763819 3:138542960-138542982 TCTGAGCCCGTAAAAACCCAAGG - Intronic
963648066 3:147942760-147942782 CCTTGGCCTCTCAAAATGCAGGG - Intergenic
963858409 3:150280527-150280549 CCTGTGCCCATAAAAACCCCAGG + Intergenic
964061522 3:152530181-152530203 CCTCGGCCCCTAAAAGTCCTGGG + Intergenic
966689423 3:182727709-182727731 CCTTGGCCTCTCAAAACACTGGG - Intergenic
967136111 3:186514143-186514165 CCTTTACACCTAAAAAACCATGG - Intergenic
968143063 3:196274219-196274241 CCTGGGCCCCCAAAAGCACAGGG + Intronic
970660068 4:18275343-18275365 CCTTGGGGTCTCAAAACCCAAGG + Intergenic
970793833 4:19889797-19889819 CCTTGGCTCAGATAAACCCATGG - Intergenic
971427454 4:26530369-26530391 CCTGTGCCCATAAAAACCCCAGG + Intergenic
974415267 4:61598945-61598967 CCTTGGCCCCTAAAAGGCATAGG - Intronic
975297304 4:72749448-72749470 CCTGTGCCCATAAAAACCCCAGG + Intergenic
978062311 4:104352715-104352737 ATTTGGCCCCTAAAAATACAAGG + Intergenic
978365667 4:107978886-107978908 ACTGGGCTCCTGAAAACCCAAGG + Intergenic
979184341 4:117770282-117770304 CCTGTGCCCATAAAAACCCCAGG + Intergenic
979543134 4:121909505-121909527 CCTTGCCCCGTACAAACCAATGG - Intronic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
980495423 4:133584203-133584225 CCTGTGCCCGTAAAAACCCCAGG + Intergenic
983186428 4:164706110-164706132 CCTGTGCCCATAAAAACCCCAGG + Intergenic
983588655 4:169383287-169383309 CCTGTGCCCATAAAAACCCGAGG - Intergenic
984543785 4:181074247-181074269 CCTGTGCCCATAAAAACCCCAGG + Intergenic
986041088 5:3994834-3994856 CCTTGTCCCCACAAAACCAAAGG - Intergenic
986444717 5:7811250-7811272 CCTTGGCCCCTCAAAATGCTGGG - Intronic
986509780 5:8491874-8491896 CCTTGCTCCCTAGAAATCCATGG + Intergenic
987005665 5:13707029-13707051 CCTGTGCCCATATAAACCCAAGG + Intronic
988311855 5:29568995-29569017 CCTTGGCCTCTGAAAGCCCTGGG + Intergenic
989411009 5:41120471-41120493 CCTTGGCCTCTAAAAATGCTGGG - Intergenic
995705010 5:114979720-114979742 CCTTGGCCTCTCAAAGCCCTGGG - Intergenic
996006773 5:118430323-118430345 CCTTGGCTCCAGAAATCCCATGG - Intergenic
996101535 5:119450179-119450201 CCTGTGCCCATAAAAACCCCAGG - Intergenic
997254814 5:132420338-132420360 GCCTGGCCCCTAAGAACCCAGGG + Intronic
997532798 5:134592601-134592623 CCTTGGCTTCTACAAACCCTTGG - Intergenic
997577878 5:134996877-134996899 CCTGGGCCACCAAAAAGCCAAGG - Intronic
998749520 5:145303803-145303825 GCTTGTCCTCTAAAACCCCAAGG + Intergenic
998856330 5:146398557-146398579 CCTGTGCCCATAAAAACCCCAGG + Intergenic
998856356 5:146398687-146398709 CCTTTGCCCATAAAAACCCCAGG + Intergenic
999230813 5:150060832-150060854 CCTTGGCCCCAGGAACCCCAAGG + Intronic
1000011615 5:157238711-157238733 GCTTGGCCCCTTCAGACCCACGG - Intronic
1001435236 5:171694773-171694795 CCTGGGACCCTCAAAAGCCATGG + Intergenic
1001541585 5:172543295-172543317 CCAGGGCCCCCACAAACCCAGGG + Intergenic
1001696496 5:173674207-173674229 CTTTGCCCCCCAAAAACCCATGG + Intergenic
1001926944 5:175644506-175644528 CCTTGGCCTCTGAAAGCCCTGGG - Intergenic
1002405141 5:179024448-179024470 CCCTGGCCCCAAAAAAACAAGGG - Intronic
1002497822 5:179627441-179627463 CCTTGGCCTCTCAAAGCCCTGGG + Intronic
1005741310 6:28793502-28793524 CCTTGGCCTCCCAAAACCCTGGG - Intergenic
1005794803 6:29348204-29348226 CCTTGGCCTATAAAAACCCGAGG - Intergenic
1007446046 6:41906977-41906999 CCCTGGACCCCAGAAACCCAGGG - Exonic
1009524694 6:64729058-64729080 CCTGTGCCCATAAAAACCCCAGG - Intronic
1012718093 6:102702062-102702084 CCTGGGCCCCTAAAAGCGCAGGG + Intergenic
1013746213 6:113349618-113349640 CCTTGGCCCCTGAAAAGGAAAGG - Intergenic
1015658483 6:135546653-135546675 CCTTGGCCCCACAGAACCCGAGG - Intergenic
1016548975 6:145255718-145255740 CCTATGCCCATAAAAACCCAAGG - Intergenic
1018915046 6:168128028-168128050 CCTTAGTCCCTAAAAACACAGGG + Intergenic
1019140799 6:169941025-169941047 CATCTGCCCCTAAAAACACAAGG - Intergenic
1020284258 7:6667961-6667983 CCTGTGCCCATAAAAACCCCAGG + Intergenic
1020739101 7:11990556-11990578 CCTGTGCCCTTAAAAACCCCAGG - Intergenic
1021162353 7:17291122-17291144 CCTTGGCCCCGCAAAGCACAGGG - Intergenic
1022275675 7:28853807-28853829 CCCTGCCCCCTAAAAAGTCAGGG - Intergenic
1022359119 7:29642381-29642403 CCTTGGCCCCCAGGAGCCCATGG - Intergenic
1025055466 7:55761333-55761355 CCTTGGCCTCCAAAAATGCAAGG - Intergenic
1025805345 7:64826085-64826107 CCTTGGCCTCCCAAAACCCTAGG + Intronic
1026053896 7:66968616-66968638 CCTTGGCCTCCCAAAACACAGGG + Intergenic
1026063241 7:67045466-67045488 CCTTGGCCTCTAAAAGTCCTGGG + Intronic
1026159431 7:67855779-67855801 CCTTGGCCTCCCAAAATCCAGGG + Intergenic
1026259396 7:68741231-68741253 CCTTGGCCCCTCAAAATGCCGGG - Intergenic
1026919533 7:74144937-74144959 CCTGTGCCCATAAAAACCCCAGG + Intergenic
1026987671 7:74564979-74565001 CCCTGGCCCCCAGAAACCCCTGG - Intronic
1028501219 7:91520793-91520815 CCTGTGCCCATAAAAACCCCAGG + Intergenic
1028652199 7:93162183-93162205 CCTGTGCCCATAAAAACCCCAGG - Intergenic
1029047928 7:97650817-97650839 TGTTGGCCCCTAAAACCCCCTGG + Intergenic
1031407998 7:121408273-121408295 CCTTGGCCTCCCAAAACACAAGG + Intergenic
1031696149 7:124857500-124857522 CCTGTGCCCATAAAAACCCCAGG + Intronic
1032506296 7:132437055-132437077 CCTTGGCCCCAAAACACGGATGG + Intronic
1033262767 7:139857982-139858004 CCTTGGCCCCCCAAAACACTGGG + Intronic
1033627834 7:143128304-143128326 CCTTGGCCCCTACATCACCAGGG + Intergenic
1033633851 7:143189638-143189660 CCTGTGCCCATAAAAACCCCAGG - Intergenic
1035169953 7:157011556-157011578 CCTCGGCCCTGAAAAACCCGTGG + Intergenic
1037366975 8:18133501-18133523 CCTGTGCCCATAAAAACCCCAGG - Intergenic
1038086466 8:24202874-24202896 CCTTTGTCCCTAACAACACAGGG + Intergenic
1038174917 8:25173027-25173049 CCTTGGCCTCTCAAAGCACAAGG - Intergenic
1038321799 8:26533993-26534015 CCTTGGACCTTCAAAGCCCATGG - Intronic
1039439316 8:37583930-37583952 CCCTGGACCCTGAGAACCCATGG - Intergenic
1039906908 8:41793124-41793146 CCTTGGCCTCTCAAAGCACAGGG - Intronic
1041499659 8:58526724-58526746 CCTTGGCCCCTCAAAATGCAGGG + Intergenic
1042004386 8:64165392-64165414 CCTGTGCCCATAAAAACCCCAGG + Intergenic
1044274389 8:90283649-90283671 CCTGTGCCCATAAAAACCCCAGG + Intergenic
1044274690 8:90285884-90285906 CCTGTGCCCATAAAAACCCCAGG - Intergenic
1044286847 8:90419945-90419967 CCTGTGCCCATAAAAACCCCAGG - Intergenic
1045381658 8:101633786-101633808 CCTAGCCCCATAAAATCCCATGG - Intronic
1045429465 8:102099691-102099713 CCTTGGCCTCTGAAAATCCTGGG - Intronic
1045442492 8:102228114-102228136 CCTGTGCCCATAAAAACCCCAGG + Intronic
1046446401 8:114325966-114325988 CCTGGCCACCTAAAACCCCATGG - Intergenic
1047827420 8:128592776-128592798 CCTTGGCCTCCAAAAACTCTGGG - Intergenic
1047878804 8:129170101-129170123 CCTGTGCCCATAAAAACCCTGGG + Intergenic
1048873879 8:138821436-138821458 CCTTGGCCCCAAGAAGCTCAAGG - Intronic
1049737452 8:144217067-144217089 CCTTGGCCTCCGAAAACGCAGGG - Intronic
1051539041 9:18193785-18193807 TCTTTGCCCCAAAAAACCCTAGG - Intergenic
1051866932 9:21694600-21694622 CCTGGGCACCTGAACACCCACGG - Intergenic
1052023116 9:23546966-23546988 CCTTGGCCTCTCAAAATCCTGGG - Intergenic
1053678199 9:40460417-40460439 CCCTGCCCCCGAAATACCCATGG - Intergenic
1053928182 9:43088763-43088785 CCCTGCCCCCGAAATACCCATGG - Intergenic
1054285525 9:63164526-63164548 CCCTGCCCCCGAAATACCCATGG + Intergenic
1054291277 9:63295954-63295976 CCCTGCCCCCGAAATACCCATGG - Intergenic
1054389297 9:64600494-64600516 CCCTGCCCCCGAAATACCCATGG - Intergenic
1054455413 9:65427791-65427813 CCTTGGCCCCTCAATGCACAGGG + Intergenic
1054506420 9:65915878-65915900 CCCTGCCCCCGAAATACCCATGG + Intergenic
1055240808 9:74183547-74183569 CCTGTGCCCATAAAAACCCCAGG - Intergenic
1057825587 9:98370118-98370140 CCTTTGCACCTACAAACTCAAGG - Intronic
1058494610 9:105542704-105542726 CCTTGGCCCCCCAAAATCCTGGG + Intronic
1059661764 9:116408490-116408512 TTTTGGCCCCTAAGCACCCAGGG - Intergenic
1059763498 9:117361661-117361683 CCCTGGACCCTAAAAAGGCAAGG + Intronic
1061230153 9:129311188-129311210 CCTTGGCCCCGAAAGACACTGGG - Intergenic
1062014864 9:134286311-134286333 CCTTGGCCCCCCAAAACACTGGG + Intergenic
1185871861 X:3671343-3671365 CCTTGGCCTCCAAAAATGCAGGG + Intronic
1186127120 X:6426179-6426201 CCTGTGCCCATAAAAACCCCAGG - Intergenic
1186128645 X:6442944-6442966 CCTGTGCCCATAAAAACCCCAGG - Intergenic
1187772356 X:22714215-22714237 GCTTTGCTCCTTAAAACCCATGG + Intergenic
1187837027 X:23442348-23442370 CCTTGTTCCCCAAAAACCTATGG + Intergenic
1189174767 X:38944966-38944988 CCCTGTTCCCTAAAAACCTATGG - Intergenic
1189382938 X:40514641-40514663 CCTTGGCCTCTCAAAATGCAGGG - Intergenic
1190167472 X:48085021-48085043 CGTGGGCCCCCAAAACCCCAGGG + Intergenic
1190859054 X:54326451-54326473 CCTTGGCCTCCAAAAACACTGGG - Intronic
1192981616 X:76350432-76350454 CCATGGCCCCTAAGAAGTCAGGG - Intergenic
1194574231 X:95592342-95592364 CCTTGGCCCCTACAGATGCATGG - Intergenic
1195721319 X:107871849-107871871 CCTGTGCCCATAAAAACCCCAGG - Intronic
1195973576 X:110500476-110500498 CCTCAGCCCCTAAAATCCCAAGG - Intergenic
1196395932 X:115261661-115261683 CCTGTGCCCCTAAAAACCTCAGG - Intergenic
1200411063 Y:2862000-2862022 CCTTGGCCTCCAAAAATGCAAGG + Intronic
1201709647 Y:16976547-16976569 CCTTGGCCTCTCAAAACGCTGGG - Intergenic
1202337595 Y:23827608-23827630 TCTTGGCCCCTGGAAACCCATGG + Intergenic
1202533171 Y:25842463-25842485 TCTTGGCCCCTGGAAACCCATGG - Intergenic