ID: 936379439

View in Genome Browser
Species Human (GRCh38)
Location 2:111970828-111970850
Sequence GAGAAGGAGGAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11535
Summary {0: 7, 1: 77, 2: 663, 3: 2492, 4: 8296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936379439_936379451 23 Left 936379439 2:111970828-111970850 CCCTCCTCCTTCTCCTCCTTCTC 0: 7
1: 77
2: 663
3: 2492
4: 8296
Right 936379451 2:111970874-111970896 CCTTCTTCTTGTTCTTTTCTTGG 0: 1
1: 1
2: 6
3: 101
4: 1027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936379439 Original CRISPR GAGAAGGAGGAGAAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr