ID: 936379451

View in Genome Browser
Species Human (GRCh38)
Location 2:111970874-111970896
Sequence CCTTCTTCTTGTTCTTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1136
Summary {0: 1, 1: 1, 2: 6, 3: 101, 4: 1027}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936379439_936379451 23 Left 936379439 2:111970828-111970850 CCCTCCTCCTTCTCCTCCTTCTC 0: 7
1: 77
2: 663
3: 2492
4: 8296
Right 936379451 2:111970874-111970896 CCTTCTTCTTGTTCTTTTCTTGG 0: 1
1: 1
2: 6
3: 101
4: 1027
936379438_936379451 26 Left 936379438 2:111970825-111970847 CCTCCCTCCTCCTTCTCCTCCTT 0: 3
1: 34
2: 358
3: 1812
4: 6835
Right 936379451 2:111970874-111970896 CCTTCTTCTTGTTCTTTTCTTGG 0: 1
1: 1
2: 6
3: 101
4: 1027
936379445_936379451 1 Left 936379445 2:111970850-111970872 CCTCCTCCTTCTCCTCCTTCTTC 0: 31
1: 592
2: 2756
3: 9009
4: 17397
Right 936379451 2:111970874-111970896 CCTTCTTCTTGTTCTTTTCTTGG 0: 1
1: 1
2: 6
3: 101
4: 1027
936379442_936379451 16 Left 936379442 2:111970835-111970857 CCTTCTCCTCCTTCTCCTCCTCC 0: 55
1: 725
2: 4147
3: 9645
4: 20404
Right 936379451 2:111970874-111970896 CCTTCTTCTTGTTCTTTTCTTGG 0: 1
1: 1
2: 6
3: 101
4: 1027
936379440_936379451 22 Left 936379440 2:111970829-111970851 CCTCCTCCTTCTCCTCCTTCTCC 0: 50
1: 652
2: 4424
3: 10166
4: 20383
Right 936379451 2:111970874-111970896 CCTTCTTCTTGTTCTTTTCTTGG 0: 1
1: 1
2: 6
3: 101
4: 1027
936379437_936379451 29 Left 936379437 2:111970822-111970844 CCTCCTCCCTCCTCCTTCTCCTC 0: 4
1: 81
2: 418
3: 1787
4: 7522
Right 936379451 2:111970874-111970896 CCTTCTTCTTGTTCTTTTCTTGG 0: 1
1: 1
2: 6
3: 101
4: 1027
936379441_936379451 19 Left 936379441 2:111970832-111970854 CCTCCTTCTCCTCCTTCTCCTCC 0: 74
1: 497
2: 3918
3: 9456
4: 19436
Right 936379451 2:111970874-111970896 CCTTCTTCTTGTTCTTTTCTTGG 0: 1
1: 1
2: 6
3: 101
4: 1027
936379444_936379451 7 Left 936379444 2:111970844-111970866 CCTTCTCCTCCTCCTTCTCCTCC 0: 83
1: 617
2: 4672
3: 10419
4: 21861
Right 936379451 2:111970874-111970896 CCTTCTTCTTGTTCTTTTCTTGG 0: 1
1: 1
2: 6
3: 101
4: 1027
936379443_936379451 10 Left 936379443 2:111970841-111970863 CCTCCTTCTCCTCCTCCTTCTCC 0: 89
1: 555
2: 4288
3: 10062
4: 20476
Right 936379451 2:111970874-111970896 CCTTCTTCTTGTTCTTTTCTTGG 0: 1
1: 1
2: 6
3: 101
4: 1027
936379447_936379451 -5 Left 936379447 2:111970856-111970878 CCTTCTCCTCCTTCTTCTCCTTC 0: 16
1: 233
2: 1992
3: 5593
4: 14639
Right 936379451 2:111970874-111970896 CCTTCTTCTTGTTCTTTTCTTGG 0: 1
1: 1
2: 6
3: 101
4: 1027
936379446_936379451 -2 Left 936379446 2:111970853-111970875 CCTCCTTCTCCTCCTTCTTCTCC 0: 18
1: 294
2: 1643
3: 7113
4: 16606
Right 936379451 2:111970874-111970896 CCTTCTTCTTGTTCTTTTCTTGG 0: 1
1: 1
2: 6
3: 101
4: 1027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936379451 Original CRISPR CCTTCTTCTTGTTCTTTTCT TGG Intronic
901353227 1:8617568-8617590 CCTTCTTCTCTTTACTTTCTTGG - Intronic
901461842 1:9396722-9396744 TCTTCTTCTTTTTTTTTTTTTGG - Intergenic
901966350 1:12870564-12870586 CCTTCTTCCTGGTTTATTCTGGG + Intronic
901981741 1:13040816-13040838 CCTTCTTCCTGGTTTATTCTGGG + Intronic
902019588 1:13333864-13333886 CCTTCTTCCTGGTTTATTCTGGG - Intergenic
902402040 1:16163208-16163230 CTTTCTTCTTTTTTTTTTTTTGG - Intergenic
902822140 1:18949930-18949952 CCTGCTTCCTTTTCTTTTCTGGG + Intronic
903085399 1:20853123-20853145 CTTTCTGCTTTTGCTTTTCTAGG - Intronic
903098852 1:21009628-21009650 CTGTCTTCTTCTTCTTTTTTTGG + Intronic
903389916 1:22956367-22956389 CCTTCTCCTTCTCCTTTTTTTGG - Intronic
903498326 1:23787176-23787198 CCTTATTCAGGTTCATTTCTAGG - Intronic
903545314 1:24120310-24120332 CCTCCTTCTGGTTCTTTTCCAGG + Exonic
904475636 1:30762936-30762958 TCTTCTTCTTCTTCTTTTTTAGG - Intergenic
905012480 1:34756818-34756840 CCTGCTCTTTGTCCTTTTCTTGG - Intronic
905932741 1:41801123-41801145 CTTGCATCTTCTTCTTTTCTGGG - Intronic
905979056 1:42206829-42206851 TCTTCTTCTTCTTGTTTTTTGGG + Intronic
906141120 1:43534055-43534077 ACTTCTTCTTGGTCTCCTCTGGG - Intronic
906260653 1:44386298-44386320 CTTTCTTTTTTTTCTTTTTTTGG + Intergenic
906565311 1:46796305-46796327 CCTTCTTCCTGGTTTATTCTTGG + Intronic
906566640 1:46805752-46805774 CCTTTTGGTTGTTTTTTTCTTGG + Intronic
906589382 1:47009846-47009868 CCTTCTTCCTGGTTTATTCTTGG - Intergenic
906758028 1:48340033-48340055 TCTTATTCTTGTTCTTTTGAAGG - Intronic
906847350 1:49207598-49207620 CTTTCTTCTTTTTATTTTCAAGG + Intronic
907046331 1:51302390-51302412 CCATCTTCCTGTTCTTTGCAGGG - Exonic
907267845 1:53273655-53273677 CCTTCTTCTGGGACTTCTCTTGG + Intronic
907329744 1:53663238-53663260 GGATCTTCTTGTTCTTTTCTAGG + Intronic
907379697 1:54076027-54076049 TCTTCTTCTTTTTTTTTTTTTGG - Intronic
908708073 1:66982429-66982451 CCTTTTTCTTCTCTTTTTCTTGG - Intronic
909044042 1:70687716-70687738 CATTCTTCTTTTTCTTTCCTGGG + Intergenic
909112969 1:71503332-71503354 TCTTCTTCTTCTTCTTTGATAGG - Intronic
909116804 1:71547681-71547703 CCTTCTTATTTTTCTCTGCTAGG - Intronic
909132835 1:71760191-71760213 CCTCCTTTTTGTTTTTTTATGGG + Intronic
909795600 1:79731895-79731917 CCTACTTTTTCTTCTTTTCCTGG + Intergenic
909858858 1:80577092-80577114 CCTGATTCTTATTCTTTTATTGG + Intergenic
910570605 1:88697954-88697976 CCTACTTCATTTTCTCTTCTAGG + Intronic
910817329 1:91305112-91305134 CTTCCTTCTTTTTCTTTTCAAGG + Intronic
910963481 1:92785196-92785218 CCTTCGCCTTCTCCTTTTCTCGG - Intronic
911032639 1:93506250-93506272 TCTTCTTCTTCTTCTTTTGGTGG + Intronic
911125655 1:94338851-94338873 CCTTCTTCATGGGCTCTTCTTGG + Intergenic
911162500 1:94695222-94695244 CCTTTTTATTTTTCTTTTTTTGG - Intergenic
911568523 1:99494155-99494177 TCTACTTCTTTTTTTTTTCTTGG - Intergenic
911824175 1:102460729-102460751 CCTTCTTCTTGTTCACTTTGTGG + Intergenic
911953514 1:104207612-104207634 ATTTGTCCTTGTTCTTTTCTAGG - Intergenic
912065074 1:105728387-105728409 CCTTCCTAATGTTCTTTTCCAGG - Intergenic
912295992 1:108471110-108471132 TCTCCTTTTTGTTGTTTTCTTGG - Intergenic
912389102 1:109289483-109289505 CCTTCTTTTTTTTTTTTTCCTGG - Intergenic
912814235 1:112816323-112816345 TCTTTTTCTTTTTCTTTTTTAGG + Intergenic
912862486 1:113226350-113226372 CCTCCTTCGTTTTCTTTTCCTGG + Intergenic
913301087 1:117369030-117369052 CCTGATTTTTGTTCTTTTTTTGG + Intronic
914345414 1:146794574-146794596 CCTTCTCCTTCTTCTCTTCGTGG - Intergenic
914475210 1:148017040-148017062 TCTTTTTCTTTTTCTTTTTTTGG + Intergenic
914841935 1:151255642-151255664 ATTTCTTCTTTTTATTTTCTCGG + Intronic
914880899 1:151546115-151546137 TCTTTTTCTTTTTCTTTTTTTGG + Intronic
915090644 1:153421880-153421902 ACTTCTTCATCTTCTTGTCTAGG + Exonic
915094863 1:153455245-153455267 ACTTCTTCATCTTCTTGTCTAGG - Intergenic
915389179 1:155525538-155525560 TCTTCTTCTTTTTTTTTTTTTGG - Intronic
915444939 1:155969276-155969298 CCTTCATCTTCTCCTTTTCCCGG + Exonic
916092297 1:161316973-161316995 TTTTCTTTTTGTTCTTTTTTTGG + Intronic
916295059 1:163209988-163210010 CTTTATTCTTTTTTTTTTCTGGG + Intronic
916416387 1:164596096-164596118 CCCTCTTTTTTTTTTTTTCTTGG + Intronic
917364890 1:174220360-174220382 TCTTTTTCTTTTTCTTTTTTAGG - Intronic
917941052 1:179922004-179922026 CTTTTTTCTTTTTCTTTTTTTGG + Intronic
917943865 1:179949614-179949636 GCTTAGTCTTGTACTTTTCTAGG - Intergenic
917980797 1:180267742-180267764 TCTCCTTCTAGATCTTTTCTGGG + Intronic
918105348 1:181411607-181411629 CCCTCTTTTTTTTCTTTTTTTGG + Intergenic
918469598 1:184858230-184858252 TCTTTTTCTTGTTCTCTTGTTGG - Intronic
918470983 1:184872996-184873018 CCTAATTCTTGTTCCTTTCAAGG - Intronic
918854339 1:189731226-189731248 CATTACTCTTTTTCTTTTCTTGG + Intergenic
919074559 1:192797779-192797801 TCTTCTTTTTTTTTTTTTCTTGG - Intergenic
919197048 1:194299354-194299376 CCTTCTTCTGTTTCTAGTCTAGG + Intergenic
919649754 1:200135520-200135542 TCTTCTTCTTTTTTTTTTTTTGG - Intronic
919704727 1:200665482-200665504 TCTTTTTCTTTTTCTTTTTTTGG - Intronic
920270434 1:204759038-204759060 CCTTCTTGCTGTCCTTTTCTTGG + Intergenic
920278604 1:204826994-204827016 CCTGCTTCTTTTTCTTCCCTGGG - Intergenic
920819722 1:209369104-209369126 ACTCCTTGTTGTCCTTTTCTTGG - Intergenic
921059786 1:211576093-211576115 CCTTAGTCTTTTACTTTTCTTGG - Exonic
921267521 1:213435718-213435740 CTTTCTTGTTGTTCTTTCCTGGG + Intergenic
921422948 1:214969785-214969807 CCTTCTTGTTCTTCTTTCCTTGG - Intergenic
921731351 1:218582833-218582855 CAGTCTTTTTGTTCCTTTCTTGG + Intergenic
921852889 1:219949867-219949889 CCTCTTTCTTGTTCTTTTGATGG - Intronic
921862764 1:220056422-220056444 CTTTCTTTTTTTTCTTTTTTTGG - Intergenic
921994665 1:221405204-221405226 CATTCTTCTTCTTCTTTGATAGG - Intergenic
922009713 1:221570556-221570578 CCTACAGCTTGTTCTTCTCTGGG + Intergenic
922205642 1:223443709-223443731 ACTTCTTCTTGTTCTGTGCTGGG - Intergenic
922626726 1:227053729-227053751 TCTTCTACTTTTTCTTTTCCTGG - Intronic
922768952 1:228171603-228171625 CCCTCAGCTTGATCTTTTCTGGG + Intronic
922950668 1:229556506-229556528 CTTTCTTCTTTTGTTTTTCTGGG - Intronic
923048381 1:230372150-230372172 CCTTCAGCTTGTTCTTTTCTGGG - Intronic
923111466 1:230893920-230893942 CCTTTTTCTTTTTCTTGTATTGG + Intergenic
923239474 1:232068336-232068358 GCTTCTACTTATTTTTTTCTTGG + Intergenic
923367584 1:233277888-233277910 GCTTCTTGGTGTTCTTTGCTTGG - Intronic
923663592 1:235979636-235979658 CCTTCTTCATGCTCCTCTCTTGG + Intronic
923965898 1:239138814-239138836 CCAACTTGTTGTTCTTTTCCTGG - Intergenic
924049277 1:240063964-240063986 CCTTCTGTTTGTTCTTATTTGGG + Intronic
924124851 1:240839828-240839850 CCTCCTACCTATTCTTTTCTTGG + Intronic
924267592 1:242298837-242298859 CTTTCTGATTGTTCCTTTCTGGG - Intronic
924279369 1:242420645-242420667 CTTTCTACTTCTGCTTTTCTGGG + Intronic
924597729 1:245461950-245461972 CCTTCTCCTTCTTCTTTTTTTGG - Intronic
1063185592 10:3647963-3647985 CCTTCTTCTTAACCTTTTTTAGG - Intergenic
1063361701 10:5464554-5464576 TCTTCTTCTTTTTTTTTTTTTGG - Intergenic
1063667284 10:8070720-8070742 CCTGCTTCTTTTTCACTTCTTGG + Intronic
1064485894 10:15789484-15789506 CCCTCTTCTATTTGTTTTCTTGG + Intronic
1064608186 10:17066697-17066719 CTTTCTTCTTTTTCTTTTTTGGG - Intronic
1064666324 10:17655969-17655991 CTTTTTTCTTTTTCTTTTTTTGG + Intronic
1064933259 10:20650985-20651007 CCTTCATATTATTCTTGTCTAGG - Intergenic
1064989149 10:21240761-21240783 CCATCTTTTAGTTTTTTTCTGGG + Intergenic
1065280371 10:24131647-24131669 CCTTCTTTTTATCATTTTCTCGG - Intronic
1065497689 10:26346473-26346495 TCTTCTTCTTCTTCTTTTTTTGG - Intergenic
1065518427 10:26547906-26547928 TCTTCTTCTTTTTCTTTTGTGGG + Intronic
1065573730 10:27098364-27098386 CTTTCTTTTTTTTCTTTTTTTGG - Intronic
1065768983 10:29059169-29059191 CCTTCTTCTTTTTTTGTTTTTGG - Intergenic
1065878435 10:30018289-30018311 TCTTCTTCTTTTTTTTTTTTTGG + Intronic
1066100658 10:32115436-32115458 TCTTCTTCTTCTTCTTCTTTCGG + Intergenic
1066112006 10:32205772-32205794 ATTTCTTCTTCTTCTTATCTTGG + Intergenic
1066786991 10:39015541-39015563 GCTTCTTCTAGTTTTTATCTGGG + Intergenic
1066790419 10:39056251-39056273 GCTTCTTGTTGTTTTTATCTGGG - Intergenic
1066793752 10:39095644-39095666 CCTCCTTCTAGTTTTTATCTGGG - Intergenic
1066794009 10:39098554-39098576 CTTTCTTCTAGTTTTTATCTTGG - Intergenic
1066794098 10:39099750-39099772 GCTTCCTCTTGTTTTTATCTAGG - Intergenic
1066800775 10:39187141-39187163 CATTCTTCTGGTTGTTCTCTAGG + Intergenic
1066929694 10:41741715-41741737 CCTTCTTCTAGTTTTTACCTTGG - Intergenic
1068361814 10:55984640-55984662 TCTTCTTATTCTTCCTTTCTTGG - Intergenic
1068742021 10:60484178-60484200 CCTTATTATTTTTCTTTTCCAGG - Intronic
1069054920 10:63834914-63834936 GCTTCTTCTTTCTCTTCTCTTGG + Intergenic
1069282364 10:66670552-66670574 CCTTCTACCTCTTCTCTTCTAGG + Intronic
1069466611 10:68645316-68645338 CCATCTTTTGGTTCTTTACTTGG - Exonic
1069484662 10:68813950-68813972 CTTTCTTCTTTTTTTTTTTTTGG + Intergenic
1069890495 10:71649291-71649313 CCTTCTCCGTGACCTTTTCTGGG + Intronic
1070018783 10:72562918-72562940 GTTTCTTCTTTTTCTCTTCTGGG + Exonic
1070608605 10:77917522-77917544 CTTTCTTCTTTTTTTTTTTTTGG - Intronic
1070668501 10:78362072-78362094 CATTCTTCTTCCTCCTTTCTTGG + Intergenic
1071254606 10:83860369-83860391 CTTTCTTCTGGTTCTTATGTTGG + Intergenic
1072302510 10:94075043-94075065 CCTTCTTCCCCTTCTCTTCTTGG + Intronic
1072303533 10:94085323-94085345 CCTCCTCCTTGTCTTTTTCTTGG - Intronic
1072351809 10:94564610-94564632 CATTCTTCCTTTTTTTTTCTTGG + Intronic
1073212010 10:101811693-101811715 TCTTTTTCTTTTTCTTTTTTTGG - Intronic
1073294889 10:102432924-102432946 TCTTCTTCTTTTTTTTTTTTGGG + Intergenic
1073544490 10:104337263-104337285 CTATTTTCTTGTTCTTTTTTTGG - Intronic
1073670567 10:105583025-105583047 CCCTCTTGTTGTTCTGTTATGGG - Intergenic
1073846259 10:107558560-107558582 CCTTCTTCTTCTATGTTTCTTGG + Intergenic
1073979182 10:109134841-109134863 ACTTCTTCTTGTTTTAGTCTTGG - Intergenic
1074440821 10:113476109-113476131 TCTTTTTCTTTTTCTTTTCCTGG - Intergenic
1074754921 10:116617260-116617282 CCTTCTTCTTACTCTCTGCTCGG - Intergenic
1075294035 10:121257401-121257423 CTGTCTTCTTGTTGCTTTCTTGG - Intergenic
1075663551 10:124214939-124214961 TTTCCTTCTTGTTCTTCTCTTGG - Intergenic
1076051871 10:127341571-127341593 CATTTTTCTGGTTTTTTTCTAGG + Intronic
1076093820 10:127713955-127713977 TCTTTTTCTTTTTCTTTTTTTGG + Intergenic
1076412329 10:130261261-130261283 CCTTCTTTTTGTTTTCTCCTTGG + Intergenic
1077161424 11:1114361-1114383 CCTTTTTCTTTTTCTGTTTTTGG + Intergenic
1077960175 11:7068242-7068264 TTTTCTTCTTGTACTTTTGTTGG + Intronic
1078204210 11:9213807-9213829 TCTTCTTCTTCTTTTTTTTTTGG - Intronic
1078491230 11:11770782-11770804 GCTTCTTTGTGTCCTTTTCTAGG - Intergenic
1078493557 11:11793081-11793103 TCTTCTTCTTTTTTTTTTCTTGG - Intergenic
1078496895 11:11826342-11826364 CATTTTTCTTTTTCTTTTATTGG - Intergenic
1078841841 11:15084138-15084160 TCTTCTTTTTCTTTTTTTCTTGG + Intergenic
1080164261 11:29218024-29218046 GCTTCTAGTTGTTCTTTACTGGG + Intergenic
1080232133 11:30028501-30028523 TCTTCTTATGGCTCTTTTCTGGG + Intergenic
1080329579 11:31120440-31120462 CTTTCTTCTGGGTCTTTTTTAGG - Intronic
1080397636 11:31904630-31904652 TCTTCTTCTTTTTTTTTTTTAGG - Intronic
1080757108 11:35212357-35212379 AATTCTTCTTTTTCTTTTTTGGG - Intronic
1080765374 11:35291585-35291607 ATTTCTTCTTGTTCATTTTTTGG + Intronic
1081015995 11:37881503-37881525 CTTTCTTCTTTTTTTCTTCTGGG + Intergenic
1081021511 11:37954169-37954191 TCTTTTTCTTTTTCTTTTTTTGG - Intergenic
1081538451 11:44012900-44012922 CCTTCTTGGTGTCCTTTACTGGG + Intergenic
1081819487 11:45977836-45977858 TCTTCTTCTTTTTTTTTTTTTGG + Intronic
1082148874 11:48706996-48707018 CTTTCTTCTAGTTCTCTTCCTGG + Intergenic
1082206308 11:49439168-49439190 TCTTCTTTTTTTTTTTTTCTTGG + Intergenic
1082294812 11:50427206-50427228 CTTTCTTCTAGTTTTTATCTGGG - Intergenic
1082303321 11:50538488-50538510 CTTTCTTCTAGTTTTTATCTTGG + Intergenic
1082311981 11:50661709-50661731 CTTTCTTCTAGTTTTTATCTTGG + Intergenic
1082312397 11:50668059-50668081 CCTTCTTCTAGTTTTTATCTTGG + Intergenic
1082574042 11:54781106-54781128 CTTTCTTCTTGTTTCTTTCCTGG - Intergenic
1082581450 11:54874434-54874456 CTTTCTTCTAGTTTTTATCTGGG + Intergenic
1082588875 11:54980008-54980030 CTTTCTTCTAGTTTTTTTCCTGG - Intergenic
1082590601 11:55004150-55004172 CATTCTTCTAGTTTTTATCTGGG + Intergenic
1082595021 11:55067539-55067561 GTTCCTTCTAGTTCTTTTCTGGG + Intergenic
1082721815 11:56687126-56687148 TCTTCTTCTTCTTCTTTTAGAGG - Intergenic
1082898141 11:58214858-58214880 CCTCCTCTTTGTGCTTTTCTTGG + Exonic
1083514853 11:63247377-63247399 CCTTCTTTTTTTTTTTTTTTAGG - Intronic
1083918938 11:65770056-65770078 CCTTCTTTTTTTTTTTGTCTTGG + Intergenic
1083981132 11:66171464-66171486 CTTTCTATTTGTTCTTTTTTTGG + Intronic
1084327964 11:68412642-68412664 TCTTCTTCTTTTTTTTTTTTTGG - Intronic
1084532120 11:69733465-69733487 CCTTCTTCCTTTTCTTTCCTAGG - Intergenic
1084616704 11:70241131-70241153 TCTTCTTCTTCTTTTTTTTTGGG + Intergenic
1084627743 11:70321613-70321635 CCTTTTTCTTTTTCTTTTTTGGG - Intronic
1085383431 11:76141054-76141076 GCTTCTCCTTGTTCTTGGCTAGG - Exonic
1085420821 11:76357571-76357593 CCTGATTCTTGTTCCTTTTTAGG - Intronic
1085552963 11:77392367-77392389 CCTTCTTTTTCTTCTCCTCTGGG + Exonic
1086397193 11:86428583-86428605 CTTTTCTCTTTTTCTTTTCTTGG + Intergenic
1086648957 11:89262604-89262626 TCTTCTTTTTTTTTTTTTCTTGG - Intronic
1087467079 11:98522509-98522531 CCTTCTACTTTTTTTTTTCTTGG - Intergenic
1087915695 11:103807863-103807885 CCTTCATCAAGCTCTTTTCTTGG - Intergenic
1088019707 11:105104716-105104738 CCTTCATGTTTTTCTCTTCTTGG + Intergenic
1088067565 11:105739185-105739207 CCTTCTGCTTATTCCTTTGTAGG + Intronic
1088108708 11:106235883-106235905 CATGCTTCTTGTTCTTTGTTTGG - Intergenic
1088188348 11:107198570-107198592 GCTTCTTCTTGTTACTTTCTAGG - Intergenic
1088207181 11:107405838-107405860 TCTTCTTCTTTTTTTTTTTTTGG - Intronic
1088251479 11:107864931-107864953 CCTTCATATTATTCTTTTATAGG - Intronic
1088260052 11:107935371-107935393 TCTTCTTCTTTTTTTTTTTTTGG + Intronic
1088382545 11:109210719-109210741 CCTTTGTCATGTTTTTTTCTGGG + Intergenic
1088411262 11:109537510-109537532 CCTTCAGCTTTTGCTTTTCTGGG + Intergenic
1088649445 11:111944505-111944527 CCTTCTTCCTGTTTTTCTTTGGG - Intronic
1088678905 11:112222332-112222354 CTTTCTTCTTCTTCTCTTCCTGG + Intronic
1088691053 11:112328320-112328342 ACTTCTTCCTGTTTTATTCTTGG + Intergenic
1089040903 11:115448694-115448716 CCCCATTCTTTTTCTTTTCTTGG - Intronic
1089308854 11:117544623-117544645 CCTTCTTCCTCTCCTTTCCTTGG + Intronic
1089343741 11:117777098-117777120 CCATGATCTTGTTCTTGTCTGGG + Intronic
1089480228 11:118798681-118798703 ACTTCATTTTGTTCCTTTCTTGG + Intergenic
1089512839 11:119011370-119011392 TCTTCTTCTTCTTTTTTTTTTGG + Intronic
1089863623 11:121612633-121612655 CCTCTTTCCTGTTCTTTCCTTGG - Intronic
1089945319 11:122465162-122465184 GCCTCTTCCTCTTCTTTTCTTGG - Intergenic
1090086161 11:123653150-123653172 TCTTCTTCTTCTTTTTTTTTTGG - Intronic
1090131336 11:124145480-124145502 CTTTCTGCTAGTTCTTTTCTTGG + Intronic
1090146160 11:124325312-124325334 CCTACTTCTGGCCCTTTTCTGGG - Intergenic
1090148685 11:124358019-124358041 CCTACTTCCTATCCTTTTCTGGG - Intergenic
1090355752 11:126139416-126139438 CCTTCTTCTGGAGCTTCTCTTGG - Intergenic
1090495777 11:127210780-127210802 GCTTCTTCTTGTTCTTTCTTTGG + Intergenic
1090586589 11:128219897-128219919 TTTCCTTCTTGTTTTTTTCTTGG - Intergenic
1090643593 11:128749499-128749521 CCTGCTTCTTGTTCTCTCTTGGG - Intronic
1090882500 11:130846394-130846416 CCTTCTCCTTGACCTTATCTTGG - Intergenic
1091156637 11:133380904-133380926 CCTTATTCTTGGTGTTGTCTTGG - Intronic
1091915168 12:4267428-4267450 TTTTCTTGTTGTTCTTTTGTTGG - Intergenic
1092179751 12:6437566-6437588 CAGTTTTCATGTTCTTTTCTTGG - Intergenic
1092317300 12:7431426-7431448 CCTTCTTCATCTTTTTTTTTTGG - Intronic
1092388291 12:8052661-8052683 CCTTCTTCGTGGTGTTATCTGGG + Intronic
1092448154 12:8576836-8576858 TCTTCTTATTTTTCTTCTCTAGG + Intergenic
1093233871 12:16582745-16582767 CCTAGTTCTGATTCTTTTCTGGG - Intronic
1093433154 12:19106365-19106387 CCTTCTTTTTTTTTTTTTTTTGG - Intergenic
1093569078 12:20644887-20644909 CCTTCTTTTTTTTTTTTTTTTGG + Intronic
1093687079 12:22069279-22069301 CCCACTTCTTGTTCTTTCCCAGG + Intronic
1093728888 12:22545198-22545220 CTTTCTTTTTTTTCTTTTTTTGG - Intergenic
1093759969 12:22898351-22898373 CATTCTTCTTGATTTTTTCATGG - Intergenic
1093896733 12:24583209-24583231 TCTTCTTCTTTTTCTTCTCTGGG - Intergenic
1094666777 12:32527963-32527985 TCTTTTTCTTTTTCTTTTTTTGG + Intronic
1094866061 12:34531450-34531472 CTTTCTTCTTGTTTTTATCCTGG + Intergenic
1094866732 12:34542153-34542175 CTTCCTTCTTGTTTTTATCTTGG + Intergenic
1095647124 12:44560643-44560665 CCTTGTTATTGGTCTTTTCAGGG - Intronic
1095987447 12:48008940-48008962 CTTTCTTCTTCTTTTTTTTTAGG - Intergenic
1096045604 12:48559620-48559642 CTTTCTTCTCCTTCCTTTCTAGG + Intergenic
1096087244 12:48873983-48874005 TCTTCTTCTTTTTTTTTTTTGGG - Intergenic
1096715143 12:53486733-53486755 CCTTCTTCTTGGCCTATTTTTGG - Intronic
1096911862 12:54991799-54991821 CCTTACTCTGCTTCTTTTCTGGG + Intergenic
1097034153 12:56111508-56111530 CCTTCTTTTTTTTCTTTTTCTGG - Exonic
1097095012 12:56540060-56540082 CCTTCTTTTTGTCTTTTTTTTGG + Intronic
1097769404 12:63564339-63564361 CTTTCTTCTTTTTCTATTATGGG + Intronic
1097907925 12:64939633-64939655 GCTTATTCTTGTTCCTTTCAAGG - Intergenic
1097945730 12:65365952-65365974 CCTTTCTCTTGCTCTTTTTTGGG + Intronic
1098227657 12:68341156-68341178 CTTTTTTCTTGCTCTCTTCTAGG - Intergenic
1098506067 12:71251858-71251880 CCTCCTTCTTCTTCTGTTTTTGG - Intronic
1098802310 12:74976565-74976587 CTTTTTTCTTGTTCTTTTTGTGG - Intergenic
1098850894 12:75594585-75594607 CCTTGTCCTTGTTCTCTGCTGGG - Intergenic
1099053973 12:77814471-77814493 TCTCCTTATTGTTGTTTTCTTGG - Intergenic
1099193034 12:79580606-79580628 CCTACTTTTTGCTCTGTTCTAGG - Intronic
1099893919 12:88621447-88621469 TCTTCCTTTTTTTCTTTTCTAGG - Intergenic
1099900732 12:88708676-88708698 GCTTCTTCTTTTTTTTTTATTGG + Intergenic
1100429707 12:94519892-94519914 CTTTCTTCTTGTTGCTTTCATGG + Intergenic
1100898438 12:99211823-99211845 CCTTGTTATTCTTCTTTTCCTGG + Intronic
1100905194 12:99290281-99290303 CCTTTTTTTTTTTTTTTTCTGGG - Intronic
1101486288 12:105164718-105164740 CTTCCTTCTCTTTCTTTTCTTGG - Exonic
1101712697 12:107283245-107283267 CCTTTTCCTTGTTCTATTGTGGG + Intergenic
1101980451 12:109401737-109401759 CCTTTTTTTTTTTCTTTTTTTGG + Intronic
1102095151 12:110233670-110233692 CCTTCTTTATGTTCTTGTCCTGG - Intergenic
1102683806 12:114708667-114708689 CCTTTTTTTTTTTCTTTTTTTGG - Intergenic
1102698187 12:114816309-114816331 CCTTCTTCTTCTTCTTTTCTTGG + Intergenic
1103312869 12:120025834-120025856 CTTTCTTTTTTTTCTTTTTTTGG + Intronic
1104220484 12:126779163-126779185 CCTTGTTTCTGTTCTTTTCAGGG - Intergenic
1105395048 13:20023933-20023955 TCTTCTTCTTTTTTTTTTTTTGG + Intronic
1105454367 13:20526380-20526402 CCTTCCTCTTGGTCTGTTCCGGG - Intergenic
1105649660 13:22361896-22361918 TCTTCTTCTTTTTTTTTTTTTGG + Intergenic
1106018475 13:25891983-25892005 CCTTTTTCTTTTTTTTTTTTTGG + Intronic
1106125010 13:26894089-26894111 CATTCTTTTTGTCTTTTTCTTGG - Intergenic
1106227076 13:27793747-27793769 CCTCCTTCTTGTGCTTCACTCGG - Exonic
1106345771 13:28876095-28876117 CTTTCTTCTTTTCCTCTTCTTGG + Intronic
1107160452 13:37220108-37220130 CCTTGTTCCTGATCTTTTGTGGG + Intergenic
1107426984 13:40303954-40303976 CCTTATGCTTTTTCTCTTCTTGG - Intergenic
1107494326 13:40910121-40910143 CTTTCTTTTTTTTCTTTTTTTGG - Intergenic
1107702154 13:43059369-43059391 TCTTCTTCTCTTTCTTTTTTTGG + Intronic
1108192145 13:47952591-47952613 CATTTTTTTTCTTCTTTTCTGGG - Intronic
1108203810 13:48067939-48067961 CCTTTATGTTTTTCTTTTCTTGG + Intronic
1108673712 13:52718020-52718042 CCTTCTTATTGGTCTATTCAGGG + Intronic
1108752733 13:53464773-53464795 CCTTCTTCTCTTTGTTTTCCTGG - Intergenic
1108792410 13:53987302-53987324 CCTTTTTCTTTTTTTTTTCTGGG + Intergenic
1109266604 13:60207852-60207874 CCCTCTTCTTTTTTTTTTTTTGG - Intergenic
1109421576 13:62118916-62118938 CCTACTTCTTTTTTATTTCTAGG - Intergenic
1109921359 13:69064253-69064275 CTTTTTTCTTGTTATTTTTTAGG - Intergenic
1110108904 13:71718057-71718079 CCCTGTGGTTGTTCTTTTCTGGG - Intronic
1110884279 13:80613775-80613797 ACTTGATCTAGTTCTTTTCTTGG + Intergenic
1111410524 13:87871395-87871417 CCATATTCTTGATCTTTCCTGGG + Intergenic
1111412327 13:87893358-87893380 CCATCTTTTGGTTCTTTACTTGG + Intergenic
1111499490 13:89097743-89097765 CTTGCTTCTTGTTCCTCTCTGGG - Intergenic
1111837383 13:93405178-93405200 CCTTCATCTTGTTTTCATCTTGG + Intronic
1112123114 13:96434684-96434706 CCTTCTTCCTGAGCTTTTCTGGG + Intronic
1112137595 13:96599142-96599164 CTTTCTTTTTGTCCTTTTCTGGG + Intronic
1112154654 13:96804146-96804168 CCTTTTTCTTTTTTTTTTTTTGG - Intronic
1112676472 13:101707852-101707874 CCTTTTTTTTTTTTTTTTCTGGG - Intronic
1113734503 13:112668639-112668661 CCTTTTCCTTGTTCTTTTTGAGG + Intronic
1114133948 14:19825434-19825456 TCTTCTTGTCTTTCTTTTCTAGG + Intronic
1114290594 14:21285303-21285325 CCTCCTTCTTGCTCTTTATTTGG - Intergenic
1114408095 14:22475058-22475080 TCTTCTTCTTCTTTTTTTTTTGG - Intergenic
1114582924 14:23780663-23780685 CTTTCTTATGGTTCTTTCCTTGG - Intergenic
1114867724 14:26617983-26618005 ATTTCTTCTTCTTCTTTTCTGGG + Intergenic
1114903073 14:27090051-27090073 CCATATTCTTGCTCTTTACTGGG - Intergenic
1114980157 14:28153554-28153576 CCTTCTCCCTTTTCTTTCCTTGG + Intergenic
1115008782 14:28519334-28519356 GTATCTTCTTTTTCTTTTCTTGG + Intergenic
1115181291 14:30629033-30629055 TCTCCTTCTTGTTCCTTTGTGGG + Intronic
1115199923 14:30842065-30842087 CCTTCTTTTTGTTTTGTTTTAGG + Intergenic
1115358363 14:32473899-32473921 TCTTTTTCTTTTTCTTTTTTTGG + Intronic
1115456758 14:33612954-33612976 CTTTTTTCTTTTTCTTTTTTTGG - Intronic
1115694025 14:35877214-35877236 CCTTCTCTTTGTTTTTCTCTGGG + Intronic
1115922170 14:38387718-38387740 TCTCCTTCTTTCTCTTTTCTTGG - Intergenic
1116582184 14:46655929-46655951 CATTCTTCTTCTTCTTTCTTTGG + Intergenic
1117092888 14:52268140-52268162 CCTTCTTCATGTCCTTCTTTGGG + Exonic
1117261256 14:54036000-54036022 CCTTCTTTATCTTCTTTTATGGG - Intergenic
1117641894 14:57808924-57808946 CATTGTTCTTCTTTTTTTCTAGG + Intronic
1117694012 14:58340223-58340245 ACTTCTTCTTCTTCTTTTTTGGG + Intronic
1117777307 14:59196136-59196158 CCTTGATCTTTTTCCTTTCTTGG + Intronic
1117999278 14:61507936-61507958 CCTCCTTTGTGTTTTTTTCTTGG - Intronic
1118134420 14:63006249-63006271 CCTTCTGTTGCTTCTTTTCTTGG - Intronic
1118457088 14:65954585-65954607 CCTTCTTCTTATTGATTTGTAGG + Intergenic
1118550424 14:66944066-66944088 CCTTTATGTTTTTCTTTTCTTGG - Intronic
1119096131 14:71833433-71833455 TCTTCTTCTTTCTCTTTGCTTGG + Intergenic
1119643059 14:76329208-76329230 ACTTCTCCTTGTTCTCTCCTGGG - Intronic
1119794329 14:77382106-77382128 TTTTCTTCTTGTTGTTTTTTTGG + Intronic
1119814720 14:77555613-77555635 ACTGCTTCTTTTTTTTTTCTTGG + Intronic
1119882152 14:78108392-78108414 TCTTCTTCTTTTTTTTTTTTTGG + Intergenic
1119972552 14:78988000-78988022 CCCTCTTCTTGTGCATTACTAGG + Exonic
1120096493 14:80394619-80394641 CATTTTTCTTTATCTTTTCTAGG - Intergenic
1120183328 14:81367571-81367593 CCTTCTCCTCCTTCTATTCTGGG + Intronic
1120184581 14:81381453-81381475 CCTTTTTCTTGCTGATTTCTGGG - Intronic
1120300401 14:82699114-82699136 CTTTCTTCTTCTTTCTTTCTTGG - Intergenic
1120403233 14:84060102-84060124 CCTTCTTCTTCTTCTTCTTATGG - Intergenic
1120496592 14:85245339-85245361 TCTTCTTTTTTTTTTTTTCTTGG - Intergenic
1120989845 14:90365488-90365510 CCTTCTTTTTTTTTTTTTTTTGG - Intergenic
1121509545 14:94502111-94502133 TCTTGTTCTTTTTTTTTTCTTGG - Intronic
1121561487 14:94879504-94879526 CATTCTTCTTATCCTTTTTTGGG - Intergenic
1122359963 14:101153245-101153267 CCTTCTCCTTCCTCTTTGCTGGG + Intergenic
1122758699 14:104003724-104003746 CCTTCTGCTTGTTCCTCACTCGG + Intronic
1123164472 14:106313617-106313639 CCTCCTTCATGTTCATTCCTAGG + Intergenic
1202844928 14_GL000009v2_random:161090-161112 TCTTGTGCTTGTTGTTTTCTTGG + Intergenic
1123577016 15:21681037-21681059 TCTTCTTGTCTTTCTTTTCTAGG + Intergenic
1123607297 15:22046632-22046654 CTTTCTTTTTTTTTTTTTCTTGG - Intergenic
1123613638 15:22123505-22123527 TCTTCTTGTCTTTCTTTTCTAGG + Intergenic
1123634411 15:22289619-22289641 CCTTCTTCTCTTTACTTTCTTGG + Intergenic
1123679468 15:22748731-22748753 TTTTCTTCTTGTTCATTTCTAGG - Intergenic
1124049416 15:26181515-26181537 CCATTTTCTTTTTCTTTTTTAGG - Intergenic
1124144251 15:27107945-27107967 TCTTCTTCATTTTTTTTTCTTGG + Intronic
1124331683 15:28823184-28823206 TTTTCTTCTTGTTCATTTCTAGG - Intergenic
1124367469 15:29082628-29082650 TTTTCTTCTTCTTCTTTTTTTGG + Intronic
1124500526 15:30223740-30223762 CGTACTTCTTGATCTTCTCTTGG - Intergenic
1124743047 15:32314927-32314949 CGTACTTCTTGATCTTCTCTTGG + Intergenic
1124825407 15:33089383-33089405 CCTTGTTCATCTTCATTTCTGGG + Intronic
1124920435 15:34021182-34021204 TCTTTTTCTTTTTCTTTTTTTGG + Intronic
1124977856 15:34543346-34543368 TCTTCTTCTTCTTTTTTTTTTGG + Intronic
1125063284 15:35450803-35450825 TCTTTTTCTTTTTCTTTTGTAGG - Exonic
1125077744 15:35639167-35639189 CCTTCTTCTTCTTCCTTTTATGG - Intergenic
1125982064 15:44011455-44011477 CCTTCTTCTATTTCTCTCCTGGG - Intronic
1126214032 15:46133201-46133223 CCTTTTTCTAGTTCTTTTAAGGG + Intergenic
1126793303 15:52240207-52240229 TCTTTTTCTTTTTCTTTTTTTGG + Intronic
1126895022 15:53248507-53248529 CCTTTTTTTTTTTTTTTTCTTGG + Intergenic
1126922071 15:53538515-53538537 CATTCTTCTTTTTCATTTCTAGG + Intronic
1127467002 15:59253925-59253947 CCTTCCCCTTTTTGTTTTCTTGG - Intronic
1127650477 15:61001861-61001883 CTTTCTTGTCGTTCTGTTCTTGG - Intronic
1129931626 15:79415769-79415791 CATGCTTCTTGACCTTTTCTGGG - Intronic
1130102746 15:80906248-80906270 CCCTCCTCTTGCTCTTTTCTGGG - Intronic
1130959316 15:88649257-88649279 CCTTCTTCCTCTTCTTTCCTCGG + Intronic
1131658561 15:94488169-94488191 CTTTCTTCTTGTTTTTATGTAGG - Intergenic
1131779075 15:95835255-95835277 CTTTTTGCTTGTTCTTTTCAAGG - Intergenic
1131927785 15:97404902-97404924 TCTTCTTCTTTTTTTTTTTTTGG - Intergenic
1132256208 15:100378662-100378684 CTTTTTTCTTTTTCTTTTCTCGG - Intergenic
1132352188 15:101146797-101146819 CCTTTTTCTTTTGCTTTTCTTGG + Intergenic
1132440371 15:101858053-101858075 TCTTTTTCTTTTTCTTTTTTTGG + Intergenic
1202985884 15_KI270727v1_random:415282-415304 TCTTCTTGTCTTTCTTTTCTAGG + Intergenic
1132481946 16:170923-170945 CCTTCATTTTGGTCTCTTCTGGG - Intergenic
1132781243 16:1627142-1627164 CCTTGTTCTTTTTTTTTTTTTGG + Intronic
1133532204 16:6665625-6665647 CCTTCTTCTTTTTTTTTTTTTGG - Intronic
1133857259 16:9561136-9561158 CCTTCTCAGTGTTCTTTGCTGGG - Intergenic
1133866313 16:9646874-9646896 CCTTCTTTTTATTCTGATCTTGG + Intergenic
1133892110 16:9889964-9889986 CCTCCTCACTGTTCTTTTCTAGG + Intronic
1133935088 16:10262708-10262730 CCCTCTTCATGTCCTTTACTAGG - Intergenic
1134073638 16:11275906-11275928 CCTTCTGCATGTTCTCTTCCTGG + Exonic
1134204546 16:12226570-12226592 CCTTCTTTTTTTTTTTTTTTTGG + Intronic
1134308167 16:13052175-13052197 GCTTCTTTTTTTTCTTTTCTTGG - Intronic
1135020873 16:18961939-18961961 CCTTCCTCTGCTCCTTTTCTGGG + Intergenic
1135114736 16:19714978-19715000 TCTTCTTCTTTTTCTTCTCTGGG + Exonic
1135493788 16:22933603-22933625 AGATCTTCTTGTTCTTTCCTGGG - Intergenic
1135684759 16:24489911-24489933 CCTTCTTGGTGGTCTTTCCTTGG + Intergenic
1135942423 16:26834207-26834229 CCTTCTTCTTCACCTTTTTTAGG - Intergenic
1136099683 16:27984754-27984776 CTTTCTTTTTTTTCTTTTTTTGG + Intronic
1136149360 16:28336767-28336789 CCTGCTTTTTTTTTTTTTCTTGG - Intergenic
1136263113 16:29095116-29095138 TCTTCTTCTTTTTTTTTTTTTGG + Intergenic
1136739273 16:32499798-32499820 CTTTCTTCTTGTTTTTGTCCTGG - Intergenic
1137246239 16:46707983-46708005 CCCTCTTTTTTTTCTTTTTTTGG + Intronic
1137383874 16:48023638-48023660 CCTTGTTCTTGCTTTTTACTGGG - Intergenic
1137838800 16:51620972-51620994 TCTTTTTCTTTTTTTTTTCTTGG + Intergenic
1137886750 16:52112603-52112625 CCTTTTTTTTTTTTTTTTCTAGG + Intergenic
1137992532 16:53173892-53173914 CTTTCTTCTTATTCTATTATAGG + Intronic
1138010323 16:53373316-53373338 ACTTCTTATTGTACTTTTCAGGG + Intergenic
1138240690 16:55424859-55424881 CCTTCTCCTTCTCCTTTTTTGGG + Intronic
1138583231 16:57955123-57955145 CCTTCCCCTTGTTCTGGTCTGGG + Intronic
1138654563 16:58483363-58483385 CCTTCTTCTTTTTTTTTTAAAGG - Intronic
1138657015 16:58497321-58497343 TTTTCTTCTTCTTCTTTTTTTGG - Intronic
1138694720 16:58802239-58802261 CCTTGCTCTTCTTCTTTTCCTGG + Intergenic
1138753203 16:59449542-59449564 ACTTCTTCTTTTTTTTTTTTTGG + Intergenic
1138938108 16:61755804-61755826 TCTTCTCCTTCTTCTTTTTTTGG + Intronic
1139013370 16:62660419-62660441 ACTTTTTCTTGTTCTTTTTTTGG - Intergenic
1139389713 16:66599430-66599452 CTTTCTTCTTTTTTTTTTCATGG + Intergenic
1139491451 16:67288253-67288275 CCTGCCTCTTGCTCTGTTCTGGG + Exonic
1139601267 16:67988903-67988925 TCTTCTTCTTCTTCTTCTCAGGG - Intronic
1139697333 16:68684561-68684583 CCTTCTTCCTCTTCTCTCCTAGG + Exonic
1139774440 16:69306936-69306958 TTTTCTTCTTTTTCTTTTTTTGG - Exonic
1140516180 16:75543645-75543667 TCATTTTCTTGGTCTTTTCTGGG + Intronic
1140778113 16:78268772-78268794 CCTTCATGTTGTTTATTTCTTGG + Intronic
1140855153 16:78971586-78971608 CCTTTTTCTTATGCTCTTCTGGG - Intronic
1140913776 16:79476942-79476964 CCATCTTATAGGTCTTTTCTGGG + Intergenic
1203013940 16_KI270728v1_random:331994-332016 CTTTCTTCTTGTTTTTGTCCTGG + Intergenic
1203029836 16_KI270728v1_random:567667-567689 GCTTCTTCTTGTTTTTATCCTGG - Intergenic
1203032275 16_KI270728v1_random:605153-605175 CTTTCTTCTTGTTTTTGTCCTGG + Intergenic
1203041885 16_KI270728v1_random:766764-766786 GCTTCTTCTTGTTTTTATCCTGG + Intergenic
1143591976 17:7890678-7890700 TCTTCTTCTCCTTTTTTTCTCGG - Exonic
1144182330 17:12763723-12763745 TCTTCTTCTTCTTCTGTTTTTGG - Exonic
1144223296 17:13119851-13119873 CCTTCTTTTTTTTTTTTTTTTGG + Intergenic
1144257029 17:13478810-13478832 CCTTCTACTTGCTCATTTTTAGG - Intergenic
1144852623 17:18251682-18251704 CCTGCTTTTTGTTCTTCTCCTGG + Exonic
1145837274 17:27964008-27964030 CTTTCTTCTCCTTCTTTCCTGGG - Intergenic
1146017710 17:29247123-29247145 CCTTCTCCCTGCTCGTTTCTTGG - Intronic
1146454377 17:32997631-32997653 TCTCCTTCTTGTTCTTCTCTGGG + Intronic
1146694004 17:34895419-34895441 CCCTTTTCTTGTTCACTTCTGGG - Intergenic
1146922708 17:36723922-36723944 CTCTCTTCTTGTGCTTCTCTGGG + Intergenic
1147404901 17:40204333-40204355 TCTTCTTCTTTTTTTTTTTTTGG + Intergenic
1147427283 17:40351923-40351945 CCTCCTTCTTCTTCTTGTTTCGG - Exonic
1147447392 17:40482886-40482908 CCTTTCTCTTCTTCTTTTTTTGG + Intronic
1147611604 17:41804972-41804994 CATTTTTCTTTTTTTTTTCTTGG - Intronic
1147644262 17:42024412-42024434 CCTTTCTCCTGTCCTTTTCTTGG + Exonic
1147854128 17:43465876-43465898 CCTTCTTCTTCTTTTTTTGATGG + Intergenic
1148330336 17:46810305-46810327 CCTTCTTATTCCTCTTTTCTAGG + Intronic
1148539113 17:48465741-48465763 CCTTCTCCTTCTTCTTTTTGAGG - Intergenic
1148540264 17:48474790-48474812 CCTTTTTTTTTTTTTTTTCTGGG + Intergenic
1149208491 17:54277008-54277030 GCTTCTTTTTTTTTTTTTCTGGG + Intergenic
1149383708 17:56121200-56121222 TGTTCTACTTGTTTTTTTCTTGG + Intronic
1149952859 17:61009635-61009657 CCCTCTTCTTGTTTGTATCTCGG + Intronic
1150299753 17:64038264-64038286 CATTCTTTCTGTGCTTTTCTGGG + Intergenic
1150729176 17:67677088-67677110 CTTTCTGGTTGTTTTTTTCTGGG + Intronic
1151278243 17:73052174-73052196 CTTTCTTCTTTTTTTTTTCTGGG - Intronic
1151394895 17:73816463-73816485 CCTGCCTTTTGTTCTGTTCTGGG - Intergenic
1151483724 17:74385641-74385663 CCTTCTTCTTCTTTTTTTTCAGG - Intergenic
1152230976 17:79114006-79114028 CCTGCTTCTGGTTTTCTTCTGGG + Intronic
1152543670 17:80990035-80990057 TCTTTTTCTTTTTCTTTTTTTGG + Intergenic
1152852408 17:82645348-82645370 CCTTTTTCTTGTGGATTTCTAGG - Intronic
1153153421 18:2121964-2121986 TCTTTTTCTTTTTCTTTTTTTGG - Intergenic
1153267541 18:3285864-3285886 CTTTGTTGTTGTTTTTTTCTGGG - Intergenic
1153307585 18:3646384-3646406 TCTTTTTCTTTTTCTTTTTTTGG - Intronic
1155070484 18:22311137-22311159 TCTTCTTCTTCTTCTTTTTTTGG - Intergenic
1155771550 18:29706953-29706975 GCTTGTTATTGGTCTTTTCTGGG + Intergenic
1156632057 18:38982034-38982056 TCTTTTTCTTATTGTTTTCTAGG + Intergenic
1156790392 18:40965586-40965608 TCTGCTTCTTTTTTTTTTCTTGG + Intergenic
1157438912 18:47695348-47695370 TCTTCTTCTTTTTTTTTTGTTGG + Intergenic
1157530183 18:48413778-48413800 CCATATTCTTGGTATTTTCTAGG - Intergenic
1157788509 18:50508290-50508312 CCTTTCTGTTGTACTTTTCTAGG + Intergenic
1157908053 18:51587146-51587168 TCTTCTTCTTCTTTTTTTTTGGG - Intergenic
1158013188 18:52752415-52752437 TCTTCTTCTTATTCATTTTTGGG + Intronic
1158210185 18:55040388-55040410 CCTTCTTTCTCTTCTTTTCTGGG - Intergenic
1158540976 18:58354374-58354396 CTTCCTTCTTGTCCTTTTATTGG + Intronic
1158890847 18:61870604-61870626 CATTCTTCCTCTTCTTTTTTTGG + Intronic
1159255538 18:65940027-65940049 TCATCTTCTTGTCATTTTCTAGG + Intergenic
1159375084 18:67582843-67582865 CCTTCTCCTTGTTCCGATCTTGG + Intergenic
1159844039 18:73437432-73437454 CCTTCTTGTAGTGCTTATCTTGG - Intergenic
1159851485 18:73531240-73531262 CTTTCTTTTTTTTTTTTTCTTGG - Intergenic
1159859777 18:73633597-73633619 CCATATTTTTGTCCTTTTCTTGG - Intergenic
1160722516 19:603745-603767 ACTTCTTCTTGATCTTCTCGGGG - Exonic
1161364754 19:3871980-3872002 TCTTCTTCTTCTTTTTTTTTTGG - Intergenic
1162993915 19:14321296-14321318 CCTTTTTCTTTTTTTTTTTTAGG + Intergenic
1164042077 19:21501871-21501893 CCTTCTTCTTTTACCTTTCAAGG - Intronic
1164043908 19:21517608-21517630 GCTTGTTATTGTTCTGTTCTGGG + Intronic
1164336550 19:24327437-24327459 GCTTCTTCTTGTTTTTATCCTGG - Intergenic
1164361849 19:27521470-27521492 CTTGCTTCTTGTTTTTGTCTGGG - Intergenic
1164421623 19:28098759-28098781 TCTTCTTCTTCTTCTTTTATAGG - Intergenic
1164641857 19:29832176-29832198 TCTTTTTCTTTTTCTTTTTTTGG + Intergenic
1166020998 19:40029259-40029281 TCTACTTTTTCTTCTTTTCTGGG + Exonic
1166078553 19:40428473-40428495 CCTTATTCTTTTTTTTTTTTAGG - Intergenic
1166210305 19:41302625-41302647 TCTTCTTCTTGTTCTCTTTGGGG + Intronic
1167549106 19:50147380-50147402 TCTTTTTCTTTTTCTTTTTTTGG - Intergenic
1168443455 19:56391782-56391804 CCTCCTTCTGGTTCCTCTCTTGG + Exonic
1168569048 19:57449325-57449347 CTTTTTTCATGTTATTTTCTAGG + Intronic
1168631333 19:57958928-57958950 CATTCTTCTTCTTCTTTTACTGG - Intronic
925517689 2:4702902-4702924 CCTCTTTCATGCTCTTTTCTGGG + Intergenic
925846093 2:8034859-8034881 TCTTTTTGTTGTTATTTTCTTGG + Intergenic
926020520 2:9491151-9491173 CCTTCTTGCTGTTTCTTTCTAGG - Exonic
926152388 2:10432419-10432441 TTTTCTTCTTGTTCCTTTCAGGG - Intergenic
926168672 2:10537036-10537058 CTTTCTTCTTCTTTTTTTTTTGG - Intergenic
926328291 2:11804250-11804272 CCTTGTTCTGGTTCTTTCCGGGG - Intronic
927175861 2:20406981-20407003 CCTTTTTCTTTTTCTTTTTTTGG + Intergenic
927270053 2:21197573-21197595 CCTTCTTTTTATTTTTTTCATGG + Intergenic
927286478 2:21362342-21362364 CCTTCTTGATGTTCTTTAATAGG + Intergenic
927388913 2:22570471-22570493 CCTTCTTCTTAATATTTTTTTGG - Intergenic
927504133 2:23602325-23602347 CTTTCTCCTTGCGCTTTTCTTGG + Intronic
927773288 2:25882398-25882420 CCTTTTTTTTTTTCTTTTTTTGG + Intergenic
928669634 2:33588444-33588466 CCTCCTTCTTGAGCTTTTTTTGG + Exonic
928869869 2:35963588-35963610 CTCTCTTCTTTTTCTTTTCTTGG - Intergenic
928905258 2:36360940-36360962 CCCTCTGCTTGTTCCTCTCTGGG - Intronic
929392627 2:41488527-41488549 CCTTCTCATTGCTCCTTTCTTGG - Intergenic
929617792 2:43325869-43325891 CTTTTTTCTTTTTCTTTTCCAGG + Intronic
929647783 2:43646812-43646834 TCTTCTTCTTTTTTTTTTTTTGG + Intronic
930093529 2:47549045-47549067 CCTTGGTCTTATTTTTTTCTAGG - Intronic
930116874 2:47725587-47725609 CTTTCTTCTTCTTTTTTTTTGGG - Intronic
930451412 2:51542905-51542927 CCTTCTTCAAGTTATTTTCTTGG - Intergenic
930814638 2:55581899-55581921 CCTTCTTCTTTTTTTTTTCTCGG - Intronic
932033865 2:68220370-68220392 CCTGCTACTAGTTCTTTTCCTGG - Intronic
932190783 2:69740205-69740227 TCTTTTTCTTTTTCTTTTTTAGG + Intronic
932300460 2:70663442-70663464 CCTTCTTTTTGCTCTTTTTCAGG + Exonic
932380507 2:71277451-71277473 TCTTTTTCTTTTTCTTTTTTAGG - Intronic
932578441 2:72976633-72976655 ACATTTTCTTGTTCTTTTTTGGG - Intronic
932835425 2:75031360-75031382 CCTTCTTCTTATTTCTTTATAGG - Intergenic
933296342 2:80495479-80495501 CTTTCTTCCTTTTCTTTTTTTGG - Intronic
933354959 2:81198607-81198629 TCTTCTCCTTGTGCTTTTCAAGG + Intergenic
933515603 2:83296748-83296770 TCTTCTTCTTGTTCCTATTTGGG - Intergenic
933677960 2:85074767-85074789 ATTTCTTCTTTTTTTTTTCTGGG + Intergenic
934931688 2:98430923-98430945 CCTTTATGTTTTTCTTTTCTTGG + Intergenic
935370656 2:102343143-102343165 CCTTCCTCTTGTTGAATTCTTGG - Exonic
935381707 2:102458345-102458367 CCTTCTTCTTCTTTTTTTTTTGG - Intergenic
936235904 2:110742409-110742431 CCTTCTTGTTCTTCTTTCCTTGG + Intronic
936379451 2:111970874-111970896 CCTTCTTCTTGTTCTTTTCTTGG + Intronic
936672078 2:114668323-114668345 CATTCATCTTCTTCTTCTCTTGG - Intronic
936764802 2:115833922-115833944 CCTTCTTATTTTTCTTTCTTAGG + Intronic
936882286 2:117268274-117268296 CCTGCTTTTTGTTCTTTTTCAGG - Intergenic
936975156 2:118211911-118211933 CATTCTAATTGTTTTTTTCTTGG - Intergenic
938872876 2:135499490-135499512 CCTTTTTCTTATTGTTTTGTAGG - Intronic
939201963 2:139047265-139047287 TCTTATTCTTGTTCTTCTATTGG - Intergenic
939341370 2:140899256-140899278 CCTTTTTCTTTTCCTTTTCAGGG + Intronic
939519309 2:143209665-143209687 TCTTCTTCCAGTTCTTTGCTTGG - Intronic
939525641 2:143290420-143290442 CCTTTTTTTTTTTCTTTTTTTGG - Intronic
939625020 2:144466321-144466343 TTTTCTTCTTTTTCTTTTATTGG - Intronic
939756064 2:146113386-146113408 TCTTCTCCTTGTTTTCTTCTAGG - Intergenic
939967368 2:148623683-148623705 CATCCTTCTTCTCCTTTTCTTGG + Intergenic
940053116 2:149484978-149485000 CCTTGTTCTGTTTCTTGTCTTGG + Intergenic
940063871 2:149604594-149604616 CCTTCTTCTTACTCTTGTGTTGG + Intergenic
940102007 2:150051309-150051331 TTTTCTGTTTGTTCTTTTCTTGG + Intergenic
940165707 2:150768368-150768390 CCTTCACCTTTTGCTTTTCTTGG + Intergenic
940322285 2:152390065-152390087 CCTTCTTCTCCTGCTTTCCTGGG - Intronic
940486652 2:154304075-154304097 CCTTCTGCTCCTTCTCTTCTAGG - Intronic
940632098 2:156252784-156252806 TCTTCTTCTTCTTCTTTTTTTGG - Intergenic
940714525 2:157205067-157205089 CCTTTTTCTTATTTTTTACTAGG - Intergenic
940876773 2:158905794-158905816 CCCTCTTTGTGTTCCTTTCTTGG + Intergenic
941257931 2:163257286-163257308 CCTTATTTTTTTTATTTTCTAGG + Intergenic
941502685 2:166299545-166299567 CTTTCTCTGTGTTCTTTTCTGGG + Intronic
941750000 2:169125268-169125290 CCTTCTTGATTTTTTTTTCTCGG - Intergenic
941876850 2:170442467-170442489 CCCTCTTCTTGTTATTTAGTAGG + Intronic
942758521 2:179370388-179370410 CTATGTTCTTGTTTTTTTCTGGG - Intergenic
942800714 2:179872537-179872559 CCTCCTTCTTGCTCTTCTATAGG - Intergenic
942982289 2:182096598-182096620 CCTTTTTCTTGTTCTTAAATAGG + Intronic
943084230 2:183293606-183293628 CCTTCTTCTTTTGCTTTTAAGGG - Intergenic
943229454 2:185229390-185229412 CCTCTTTCTTTTTCTTTACTGGG - Intergenic
943293959 2:186113831-186113853 TCTTCTTTTTTTTCTCTTCTGGG + Intergenic
943308396 2:186296398-186296420 CCTGCTGCTTATTCTTCTCTGGG - Intergenic
943363268 2:186946134-186946156 CCTTCTTAGTGTTGATTTCTTGG - Intergenic
943788530 2:191905951-191905973 CCTGCCTCATGTTCTTTTCCAGG - Intergenic
944323285 2:198374816-198374838 CCTTCTTTCTATTCTTTTCTTGG + Intronic
945607201 2:211949709-211949731 CTTTCATCTTGTTATCTTCTTGG + Intronic
946512593 2:220375290-220375312 CCTTGTTCTTGTTCTTTTCCTGG - Intergenic
946529147 2:220552841-220552863 CCTTCTGCTGGATCTTTCCTTGG + Intergenic
946717101 2:222564102-222564124 CATCCTTCTTGTTCCTCTCTTGG + Intergenic
946925525 2:224623080-224623102 CTTTTTTTTTTTTCTTTTCTTGG + Intergenic
946983292 2:225243240-225243262 CATTCATGTTCTTCTTTTCTGGG - Intergenic
947069413 2:226270402-226270424 TCTTCTCCGTGTTTTTTTCTGGG - Intergenic
947185671 2:227453204-227453226 CCTTCTTTTTTTTTTTTTCCAGG + Intergenic
947522390 2:230857232-230857254 TCTTCTTCTTTTTTTTTTTTTGG - Intergenic
947924671 2:233911003-233911025 CTTTCTTGTTGCTCTCTTCTAGG + Intergenic
947941378 2:234058979-234059001 TCTTCCTTTTGTTCATTTCTGGG - Intronic
948021604 2:234737995-234738017 CTCTCTGCTTGCTCTTTTCTTGG + Intergenic
948207571 2:236170283-236170305 TTTTCTTTTTCTTCTTTTCTGGG - Intergenic
948555355 2:238806335-238806357 CCTTCTTTTTTTTTTTTTTTTGG + Intergenic
948677525 2:239607560-239607582 CCATCTTTTGCTTCTTTTCTTGG - Intergenic
949018127 2:241725007-241725029 ACTTCTTCTTCCTCTTTTCCTGG - Exonic
949039597 2:241841760-241841782 CTTTCTTCCTTCTCTTTTCTTGG - Intergenic
1168841566 20:913263-913285 CCTTCCTCTGGTTCTTCTCTTGG - Intronic
1168995572 20:2130351-2130373 GCTGCGTTTTGTTCTTTTCTTGG + Intronic
1169173643 20:3488652-3488674 CCTTATTCTTGTTCTTTTTCAGG + Intronic
1170034787 20:11979018-11979040 GTTGCTTCTAGTTCTTTTCTTGG + Intergenic
1170147121 20:13187801-13187823 CCTTATCCTTGTTCTTCTTTAGG - Intergenic
1170159228 20:13295629-13295651 CCTTCCTCTTTATCTTTCCTGGG - Intronic
1170274440 20:14568444-14568466 CCTTCTTATTGTTCTATTTGTGG + Intronic
1170375456 20:15695404-15695426 TCTTCTTCTTTTTTTTTTTTTGG + Intronic
1170528307 20:17263122-17263144 CCTTTTTCTTTTTTATTTCTTGG - Intronic
1172556681 20:35848266-35848288 TTTTTTTCTTGTTCTTTTTTGGG + Intronic
1172725751 20:37039734-37039756 TCTTCTTTTTCTTTTTTTCTGGG + Intronic
1172820578 20:37729862-37729884 CCTTTTTATTTTTCTTTTTTAGG + Intronic
1173042178 20:39474924-39474946 CCTTGTCCTGGTTCATTTCTTGG + Intergenic
1173668442 20:44780024-44780046 CCTCCTTCCTGTCCTGTTCTGGG - Intronic
1174454945 20:50642240-50642262 CCTTCTTCTTCTTGATTGCTGGG + Intronic
1174619673 20:51864514-51864536 CCCTCTGAATGTTCTTTTCTGGG - Intergenic
1174957294 20:55112978-55113000 ACTTCTTTCTGTTTTTTTCTTGG - Intergenic
1175690436 20:61061826-61061848 ACTTTTTGTTGTTGTTTTCTAGG + Intergenic
1176225430 20:63995608-63995630 CCTTCTCCTTTTTTTTTTTTTGG + Intronic
1176963527 21:15186608-15186630 CTTTTCACTTGTTCTTTTCTTGG + Intergenic
1177161379 21:17551623-17551645 TGTTCTTCTTTTTCTTTTCTGGG + Intronic
1177438763 21:21090427-21090449 TTTTATTCTTGTTATTTTCTGGG + Intronic
1177488851 21:21794788-21794810 CCTTCTTTTTGTTCCTCTTTTGG + Intergenic
1177590434 21:23157976-23157998 CATTCATCATTTTCTTTTCTGGG + Intergenic
1177871409 21:26577551-26577573 TTTTCTTCTTGTTTTCTTCTGGG - Intergenic
1177936481 21:27352581-27352603 TTTTCTTCTTGTTCATTTCCTGG + Intergenic
1178570163 21:33728526-33728548 CCTTCTTCCTGTTCTTTAAATGG + Intronic
1179091414 21:38269457-38269479 CCTTGTCATTGTTTTTTTCTGGG + Intronic
1179190839 21:39120471-39120493 TCTTATTTTTGTTCTTTTGTAGG - Intergenic
1179965281 21:44801402-44801424 TCTTCTATTTTTTCTTTTCTTGG - Intronic
1180114251 21:45686919-45686941 CCTTCTTCTCCTCCTCTTCTGGG - Intronic
1180571554 22:16726928-16726950 TCTTTTTCTTTTTCTTTTTTTGG - Intergenic
1180902425 22:19384520-19384542 CCCACTGCTTGTTCTTTGCTTGG - Intronic
1181402432 22:22659177-22659199 CCTTCTACTTCTAGTTTTCTGGG - Intergenic
1181910647 22:26235676-26235698 CCTTTTGCTTGTCATTTTCTTGG - Intronic
1182730630 22:32488670-32488692 GCTTATTCTTGTTCATTCCTAGG + Intronic
1182751780 22:32647252-32647274 GCCTCTTGGTGTTCTTTTCTCGG + Intronic
1182842810 22:33405537-33405559 CCTTCTTTTCCTTTTTTTCTAGG + Intronic
1182984050 22:34699759-34699781 CCTCCTTCATGTGGTTTTCTGGG + Intergenic
1183764126 22:39854695-39854717 TCTTTTTTTTTTTCTTTTCTTGG - Intronic
1185249499 22:49792699-49792721 CCTGTTTGTTGTTCTGTTCTGGG - Intronic
949100264 3:135655-135677 TCTTCTTCTTTATATTTTCTTGG + Intergenic
949100419 3:137398-137420 CCTTCTTTATGGCCTTTTCTTGG + Intergenic
949912908 3:8928174-8928196 ACTTCTTTTTGTTTTTTTGTAGG - Intronic
949971166 3:9406262-9406284 CCTTCTCTTTGTTCTGTTTTAGG - Intronic
950008877 3:9708380-9708402 CCTTCTCAGTCTTCTTTTCTAGG - Intronic
950240782 3:11368325-11368347 CCTTTTTCTGGTTCTTTGGTAGG + Intronic
950591200 3:13936591-13936613 TCTTCTTCTTGTACTTGTCCGGG - Intergenic
950712298 3:14820997-14821019 TCTTCTTCTTGTACTTGTCCGGG - Exonic
950851175 3:16063648-16063670 CCGTCTTTTCTTTCTTTTCTGGG + Intergenic
951104505 3:18727389-18727411 CCTTGTCCTTTTTCCTTTCTTGG - Intergenic
951289704 3:20860827-20860849 CTTTCTTCTTGTTTTCTCCTGGG - Intergenic
951301886 3:21008522-21008544 CCTTTTTTTTTTTTTTTTCTTGG - Intergenic
951443848 3:22754048-22754070 CTTTCATCTTGTCCTTTTCTAGG + Intergenic
951725171 3:25749943-25749965 CCTTCTTTTTTTTTTTTTTTTGG - Intronic
951879645 3:27467556-27467578 ATTTCTTCTTCCTCTTTTCTTGG - Intronic
951947780 3:28161124-28161146 CTTTGTTGTTGTTTTTTTCTAGG - Intergenic
951963909 3:28360799-28360821 CCTGCTTTTTTTTCTTTTCAAGG - Intronic
952833587 3:37585623-37585645 CATTCTTCATGTTCCCTTCTTGG - Intronic
953008709 3:39002909-39002931 TCATGTTCTTGTTCTTTTTTAGG + Intergenic
953458091 3:43059968-43059990 CTTTCTTCTTGCCATTTTCTAGG - Intronic
953743479 3:45556034-45556056 CCATCTTGTTTTTTTTTTCTAGG + Intronic
953784704 3:45902447-45902469 TGTTCTCCTTGTTCTGTTCTGGG + Exonic
953837181 3:46356917-46356939 CCTTCTTTTTTTTTTTTTTTTGG - Intronic
953867850 3:46599701-46599723 CTTTCTTCTTTCTCTTCTCTTGG - Intronic
954319711 3:49823652-49823674 TCTTCTTCTTTTTTTTTTTTTGG + Intergenic
954350450 3:50038832-50038854 TCTTCTTTTTCTTCTTTTTTTGG - Intronic
954625906 3:52021717-52021739 TCCTTTTCCTGTTCTTTTCTCGG + Intergenic
955261670 3:57397281-57397303 TCTTGTTCATGCTCTTTTCTGGG - Intronic
955301673 3:57785968-57785990 CCTTCTACTACTACTTTTCTAGG + Intronic
955339685 3:58115869-58115891 CCTTCTTGTTGTTTGTTGCTTGG + Intronic
955602708 3:60664453-60664475 CCTCCTTCTTCTTCTTTGCCTGG + Intronic
955644934 3:61126974-61126996 CCTTCCTCCTGCTTTTTTCTTGG - Intronic
956545529 3:70397302-70397324 TCTTCTTCTTTTTGTTTTTTTGG + Intergenic
956546849 3:70413415-70413437 CCTTCTCCTGGTCCTTTTCAGGG - Intergenic
956595969 3:70967635-70967657 CTTTCTTTTTGTTTTTTTTTTGG + Intronic
956611093 3:71123756-71123778 CATTCTTCTTCTTCTTTTTTTGG + Intronic
956821519 3:72958527-72958549 CCTGCTTTTTTTTCTTTTCGAGG - Intronic
957106638 3:75897539-75897561 TCTTTTTCTTTTTCTTTTTTTGG + Intergenic
957284473 3:78200443-78200465 CCTTCTCCATTTTGTTTTCTTGG - Intergenic
957369309 3:79271556-79271578 CTTTCTTCCTGCTCTTTTTTTGG + Intronic
957377460 3:79376887-79376909 CTTACATCTTGTTATTTTCTTGG - Intronic
958048574 3:88317222-88317244 TTTTCTTCATGTCCTTTTCTGGG - Intergenic
958537932 3:95428010-95428032 GGTTTTTCTTTTTCTTTTCTGGG - Intergenic
958556320 3:95682132-95682154 CCTCCTTTTTCTTCTTTACTTGG + Intergenic
958650360 3:96929922-96929944 CATTCTTTTTTGTCTTTTCTTGG + Intronic
958704373 3:97635206-97635228 CTTTCTTTATGTTCTTTTATAGG - Intronic
958735599 3:98006106-98006128 CCTTCTTCTCCTCCTTTTCTCGG - Intronic
958750181 3:98186279-98186301 CCTTTTTGTTTTTCTCTTCTTGG - Intronic
958897877 3:99849797-99849819 CCTTAATCTTATTGTTTTCTTGG + Exonic
959209051 3:103352578-103352600 TCTTCGTCTTCTTCTTTTTTAGG - Intergenic
959294924 3:104522795-104522817 TCTTCTTCTTTTTTTTTTTTAGG - Intergenic
959437175 3:106330288-106330310 CCAGCTTCTTGTTCTATTCAGGG - Intergenic
959747064 3:109787998-109788020 CCATATTCTTGATCTTTTGTAGG - Intergenic
960129244 3:114036643-114036665 CCTTCTGCTGCTTCTTGTCTTGG + Exonic
960315799 3:116175221-116175243 CTTTCTTCTTTTTCTTTCTTTGG + Intronic
960348051 3:116559200-116559222 TCTTCTTCTTTTTTTTTTCTTGG - Intronic
960455850 3:117870448-117870470 CCTTCTTCTCTTTCCTTTGTGGG + Intergenic
960476823 3:118140589-118140611 GCTTCTTATTGTTCTATTCAGGG + Intergenic
961117181 3:124340522-124340544 TCTTCTTCTTCTTCTTTTTTTGG - Intronic
961717749 3:128870357-128870379 TCTGCTCCTTGTTCCTTTCTGGG + Intergenic
961931191 3:130534791-130534813 CTTCCTTCGTTTTCTTTTCTGGG + Intergenic
962088585 3:132218806-132218828 TCTTCTTCTAATTCTTTTGTAGG - Intronic
962173383 3:133126474-133126496 CTTTCTTTTTTTTTTTTTCTGGG - Intronic
962374332 3:134847618-134847640 CCTTCTTCTTGTCCTCATCTTGG - Intronic
962444957 3:135455875-135455897 CCATCTTCTTGTTCTCTCTTGGG - Intergenic
963965550 3:151365828-151365850 GTGTCTTCTTTTTCTTTTCTAGG + Exonic
964537410 3:157738933-157738955 CTTTCTTCTCTTTTTTTTCTGGG + Intergenic
964558312 3:157965189-157965211 CTTTCTCCTTATTCTTATCTTGG - Intergenic
964597915 3:158457583-158457605 CCTTCTTGGCGTTCTATTCTTGG - Intronic
964651132 3:159012868-159012890 ATGGCTTCTTGTTCTTTTCTTGG + Intronic
964757486 3:160101711-160101733 TCTTTTTCTTTTTCTTTGCTGGG - Intergenic
964818329 3:160741123-160741145 TCTTCTTCTTCTTCCTTTTTAGG - Intergenic
965440204 3:168703194-168703216 GTTTCCTTTTGTTCTTTTCTTGG - Intergenic
965517859 3:169641180-169641202 CCTTAATCTTGCTCTGTTCTGGG - Intronic
965619788 3:170631505-170631527 CCTTCTAGATTTTCTTTTCTGGG + Intronic
965907481 3:173726939-173726961 TCTTCTTCTTTTTTTTTTTTTGG - Intronic
966056275 3:175694509-175694531 GCTCATTCTTGTTATTTTCTTGG + Intronic
966108587 3:176367196-176367218 CCTTCTTTTTTTTTTTTTTTTGG + Intergenic
966183717 3:177209817-177209839 CCTTGTTGTTGTTGTTTTTTGGG + Intergenic
966418145 3:179710304-179710326 CCTTCTCCTTGTCCTTTTAGGGG + Intronic
966844810 3:184120329-184120351 CTTTCTTCTTCTTCTTTTTTTGG - Intergenic
967112173 3:186303679-186303701 CCTGCCTCTTTTGCTTTTCTGGG + Intronic
967366348 3:188690700-188690722 CATTCTTCTTCTTCTTTTAGGGG + Intronic
967418978 3:189252549-189252571 CCTCCTTCCTCTACTTTTCTGGG - Intronic
967534820 3:190590250-190590272 TCTTCTTCTTTTTTTTTTTTTGG + Intronic
967547935 3:190753650-190753672 GCTTCTTCTTGCTCTTTTATTGG + Intergenic
967758731 3:193199895-193199917 ACTTCTTCCTGTTTTATTCTTGG + Intergenic
967817371 3:193810819-193810841 ACTGCCTCTTTTTCTTTTCTTGG + Intergenic
967864598 3:194179819-194179841 TCTTCTTCTTTTTTTTTTTTGGG - Intergenic
967881786 3:194306603-194306625 CCTTCCTCTCGTTGTTTTCCTGG + Intergenic
967895674 3:194394618-194394640 CCTTGTTTTTCTTCTATTCTTGG - Intergenic
968679807 4:1909637-1909659 CCTTTTTTTTTTTCTTTTCCTGG + Intronic
968791896 4:2670890-2670912 CCTTGTTTTTGTTATTTCCTGGG + Intronic
969077165 4:4589380-4589402 TCTTCTTTTTTTTTTTTTCTTGG + Intergenic
969140271 4:5065000-5065022 CCTTCTCCTTCTTCTTTGCAAGG + Intronic
969840170 4:9875753-9875775 ACTTCTTCCTCTTCTTTACTTGG + Intronic
970398438 4:15695194-15695216 TCTTCTTCTTTTTTTTTTTTTGG + Intronic
970518493 4:16859226-16859248 CATTTTTCTTTTTCTTTTTTTGG - Intronic
970948010 4:21717655-21717677 GCTTCTTATTTTTCTTTACTGGG + Intronic
971037959 4:22715740-22715762 CTTTCCTCTTGTTCTCTTCCTGG + Intergenic
971079175 4:23189007-23189029 CCTTCTTCCTTTTATTTTTTTGG + Intergenic
971321232 4:25607544-25607566 TTTTCTTTTTGTTCCTTTCTTGG - Intergenic
971606388 4:28663614-28663636 TCTTCTTCTTCTTCTTTTTTTGG - Intergenic
971737361 4:30472464-30472486 GTTTCTTATTGTTCTTTTGTGGG + Intergenic
971783008 4:31062676-31062698 CTTTCTTCATATTCTTTTCAGGG + Intronic
971787091 4:31118535-31118557 TCTTCTTTTTTTTCTTTTTTAGG - Intronic
972072817 4:35042876-35042898 TCTTTTTCTTATTCTTTTGTTGG + Intergenic
972292683 4:37704528-37704550 CCCTCTTATTTTTCTTCTCTAGG + Intergenic
972308232 4:37853054-37853076 CTTTCTTCTTCTGTTTTTCTGGG + Intronic
972313557 4:37903683-37903705 CCTTTTGCTTGTTCATTTGTTGG + Intronic
972430070 4:38972556-38972578 CTTTCTTTTTTTTTTTTTCTGGG + Intronic
972580822 4:40394316-40394338 TCTTTTTCTTTTTCTTTTTTTGG - Intergenic
972761057 4:42104821-42104843 CCTTCTTCCTCTTCTTTTTCTGG - Intergenic
973122858 4:46544291-46544313 CCTTCCTACTGTTATTTTCTTGG - Intergenic
973239587 4:47943233-47943255 TTTTCTTCTTTTTCTTCTCTGGG + Exonic
973282478 4:48374233-48374255 CTTTATTCTTTTTCTTTTTTTGG + Intronic
973305057 4:48638329-48638351 CCTTCTACTTTTTCTTTTGTAGG - Intronic
973544803 4:51970274-51970296 ACTTCTTCTTGTTCCAGTCTTGG + Intergenic
973685400 4:53365158-53365180 TCTTCTTCCTGTTCTTTGCAGGG + Exonic
973759298 4:54101766-54101788 CCTCCTTCTTGTGCTTCACTCGG - Exonic
973956888 4:56071366-56071388 TATTCTTCTTGTTTTTGTCTTGG + Intergenic
974359982 4:60865054-60865076 CCTTCTTCTTGTCCTTTCCCTGG + Intergenic
974382188 4:61155158-61155180 CTTTCTTTTTGTTCTTTTACTGG - Intergenic
974732441 4:65885761-65885783 CCTTCCTCTCTTTCATTTCTAGG + Intergenic
976525205 4:86078998-86079020 CATTTTTCTTTTTCTTTTTTTGG - Intronic
976618708 4:87105756-87105778 CCTGTTTTTTGTTCTTTTCCTGG + Intronic
976637764 4:87304357-87304379 CTTTCTTCCTTTTCTTCTCTTGG + Exonic
976987553 4:91321057-91321079 ACTTCTTCCTGTTATTTTATAGG + Intronic
977088044 4:92629784-92629806 TTTTTTTCTTGTTCTTTACTGGG + Intronic
977284785 4:95089305-95089327 GCTTTTTGTTGTTCTTTTTTTGG + Intronic
977349668 4:95866061-95866083 CATTTTTGTTGATCTTTTCTGGG + Intergenic
978268524 4:106858853-106858875 TCTTCTTCTTCTTCTTCTTTGGG - Intergenic
978368672 4:108008622-108008644 TCATCTCCTTGTTCTTCTCTGGG + Intronic
978645718 4:110928952-110928974 CATTTTTCTTTTTCTTTTTTAGG + Intergenic
978971402 4:114811565-114811587 CCCTCTTCTGTTTCTTTCCTCGG + Intergenic
979027994 4:115601834-115601856 CCACTTTCTTGATCTTTTCTTGG - Intergenic
979479345 4:121198046-121198068 GCATCCTCTAGTTCTTTTCTAGG - Intronic
979708067 4:123745199-123745221 CCTTTTTCTTGTTCCTTTTCAGG - Intergenic
979710631 4:123774832-123774854 TCTTCTTCTTCTTTTTTTTTAGG + Intergenic
979879011 4:125930151-125930173 CTTTCTTTTTTTTTTTTTCTTGG - Intergenic
979976354 4:127201267-127201289 ACTTCTTCTTGGTCTAGTCTTGG - Intergenic
979982193 4:127270897-127270919 CCTTTTTCTTTTTGCTTTCTTGG - Intergenic
981063294 4:140451411-140451433 TTTTCATATTGTTCTTTTCTAGG + Exonic
981068075 4:140506509-140506531 TATTTTTCTAGTTCTTTTCTAGG - Intergenic
981309182 4:143279716-143279738 TCTTTTTCTTTTTCTTTTTTTGG + Intergenic
982126062 4:152184902-152184924 CTTTTTTCTTTTTCTTTTTTTGG - Intergenic
982333832 4:154212018-154212040 CCTTCTTTTTTTTTTTTTTTAGG + Intergenic
982590347 4:157301339-157301361 CATACTTTTTGTTCTTGTCTGGG - Intronic
982602726 4:157471631-157471653 CCTTTATGTTTTTCTTTTCTTGG + Intergenic
982746240 4:159105630-159105652 CATTGATCTTGTTCTTCTCTTGG + Intronic
983099608 4:163608741-163608763 CCTTCTTCCTTTTCTGTTCCTGG - Intronic
983231489 4:165133599-165133621 ATTTCTTCTTATTCTTTTCTTGG + Intronic
983949741 4:173625913-173625935 CCCTCTGCTTTTGCTTTTCTGGG + Intergenic
984246750 4:177283956-177283978 TCTTCTTTTTCTTCTTTTTTTGG + Intergenic
984465289 4:180092828-180092850 CCTTCATCTTGTGCCTTTCTTGG + Intergenic
984916582 4:184730377-184730399 CCTTCTGCTTGTTCTGCCCTGGG - Intronic
985035613 4:185837248-185837270 CTTTCATCTTTTTTTTTTCTAGG - Intronic
985041134 4:185892983-185893005 CCCTATTCTTGTTTTTTTCAAGG - Intronic
985338390 4:188920861-188920883 GGTTCTTCTTGTTCTTATTTGGG - Intergenic
986105722 5:4657572-4657594 ACTTTTCCTTTTTCTTTTCTTGG - Intergenic
987220538 5:15786524-15786546 CCAACTGCCTGTTCTTTTCTGGG + Intronic
987384707 5:17318356-17318378 CCTTCTTCTGGTTCTTAATTAGG - Intergenic
987421209 5:17721979-17722001 CCTTTTTTTTTTTTTTTTCTGGG + Intergenic
987553511 5:19414811-19414833 CCTTCTCCTTGTCTTTTTATGGG - Intergenic
987791878 5:22578718-22578740 TCTTCTTCTTCATCTTTTTTTGG + Intronic
987866036 5:23540357-23540379 CCTTCTTCCTTTTGTTTTCAGGG + Intergenic
988128709 5:27075696-27075718 CCTTCTTTGTCTTCTTTTGTTGG - Intronic
988308755 5:29529472-29529494 CATTCTTCTTATCATTTTCTGGG - Intergenic
988789761 5:34596688-34596710 TCTTCTTCTTCTTTTTTTTTTGG - Intergenic
988869613 5:35374221-35374243 CATTCTTTTTTTTCTTTTTTTGG - Intergenic
988978521 5:36540000-36540022 CCTCCGTCTTGTTCATTTTTAGG - Intergenic
989028358 5:37091518-37091540 CCCTCTTCTGGCTGTTTTCTGGG - Intergenic
989534970 5:42552722-42552744 CCTTCTGATTCTTGTTTTCTGGG - Intronic
989844659 5:46126543-46126565 CCTTCCTCTTGTATTTTTCCTGG + Intergenic
989852186 5:46227634-46227656 CTTCCTTCTTGTTATTATCTTGG - Intergenic
990044302 5:51410115-51410137 GCTGCTTCTTGTGCTGTTCTTGG + Intergenic
990763115 5:59152553-59152575 CCTTCGTCTTACTCATTTCTAGG - Intronic
991600241 5:68344717-68344739 GCTTCTCCTTTATCTTTTCTTGG - Intergenic
991603704 5:68379274-68379296 CCTTCTTTTTTTTTTTTTTTTGG - Intergenic
992507380 5:77400517-77400539 CCATCTTGTTTTTCTTTTCTTGG + Intronic
992824905 5:80539045-80539067 CTTTCTTGTTTTTCTTTCCTAGG + Intronic
993120494 5:83768439-83768461 CTTTATGCTTTTTCTTTTCTTGG + Intergenic
993506783 5:88718532-88718554 TTTTCTTCTTTTTCTTTTCCTGG - Exonic
993508066 5:88735923-88735945 CTTGTTTCTTTTTCTTTTCTAGG + Intronic
993530816 5:89023065-89023087 TTTTCTTCTTTTTCTTTACTAGG + Intergenic
993741321 5:91543848-91543870 CCTTCTTCTTTTTTTTTTTTTGG + Intergenic
993935674 5:93998890-93998912 GCTATTTCTTTTTCTTTTCTTGG - Intronic
993986631 5:94605228-94605250 ACTTCTTATTGTTCTGTTCAGGG - Intronic
994086498 5:95765446-95765468 CCTTCTTCCTGTGCTTTCCCAGG + Intronic
994971877 5:106749488-106749510 GCTTATTGTTGTTGTTTTCTGGG - Intergenic
995246938 5:109945446-109945468 CTTTCCTCTTGATCTTTTCTGGG - Intergenic
995439978 5:112180845-112180867 CCTTTTTCTTATTCATTTGTAGG - Intronic
996357688 5:122615029-122615051 TCTTTTTCTTTTTCTTTTTTTGG - Intergenic
996577733 5:124994766-124994788 CTTTCTTCTTTTTTTTTTCTTGG + Intergenic
996861398 5:128071407-128071429 TCTTTTTCTTTTTTTTTTCTTGG + Intergenic
996919202 5:128747767-128747789 TCTTCTTGTTGCTCTATTCTAGG + Intronic
997176544 5:131784004-131784026 CCTTCTTTTTTTTTTTTTGTTGG - Intronic
997325051 5:133013257-133013279 CCTTTTTTTTTTTTTTTTCTTGG - Intronic
997483763 5:134210814-134210836 CATTCTTTTTTTTCTTTTTTGGG - Intronic
997722838 5:136094141-136094163 CCTGATTTTTGTTCTTTTTTGGG + Intergenic
998131625 5:139654184-139654206 CCTTGTTTTTGACCTTTTCTGGG + Intronic
998316433 5:141187360-141187382 CCTGTTTCTTTTTCTTTTCTGGG + Exonic
998317052 5:141192594-141192616 CCTGTTTCTTTTTCTTTTTTGGG + Exonic
998525336 5:142837696-142837718 GATTCTTCTTGTTCCTTTTTGGG + Intronic
998844193 5:146290385-146290407 CCTTTTCTTTTTTCTTTTCTGGG - Intronic
999230597 5:150059671-150059693 CCTTTTTCTTGTCCTTTGCCAGG + Intronic
999670199 5:153952974-153952996 CTTTCTTCCTGTTCTCTTCTTGG + Intergenic
999756831 5:154670767-154670789 ACTTCTTCTTGTCCTTTTCTAGG + Intergenic
999906967 5:156151822-156151844 TCTTCTTCTTCTTTTTTTTTTGG + Intronic
1000077462 5:157804928-157804950 TCTTTTTCTTTTTCTTTTTTTGG - Intronic
1000146918 5:158462381-158462403 CCATCTTCTCTTTCATTTCTTGG + Intergenic
1000400365 5:160820399-160820421 GCTTTTTTTTGTTTTTTTCTGGG - Intronic
1000933143 5:167277034-167277056 CATTCTTATTGATCTTTTCAAGG + Intergenic
1000943694 5:167394380-167394402 CTTTCTTCTTTTTGTATTCTTGG + Intronic
1001243178 5:170085707-170085729 CCTTCTTGATGCTGTTTTCTGGG + Intergenic
1001632207 5:173183757-173183779 CCTTCATCTTTCTCTCTTCTGGG + Intergenic
1001790210 5:174449799-174449821 CCTTCTTCTTCTTCTTCTTCAGG - Intergenic
1002148715 5:177208486-177208508 TCTTTTTCTTTTTTTTTTCTTGG + Intronic
1003058854 6:2846796-2846818 CCTTCTTCTAATTCTGGTCTCGG + Intergenic
1003537107 6:6984987-6985009 TCTTCTTCTTTTTGTTTTCCTGG - Intergenic
1004002131 6:11605221-11605243 CCCTGTTTTTGTTCTTTCCTGGG - Intergenic
1004031664 6:11876246-11876268 CTTTCTTTTTTTTCTTTTTTTGG - Intergenic
1004073201 6:12321120-12321142 CCCTCTCCTTGTTTTTTTATGGG - Intergenic
1004395038 6:15240451-15240473 TCTTCTTCTTTTTTTTTCCTTGG + Intergenic
1004405253 6:15327151-15327173 CCTTCCTCCTTTTCTTTTTTGGG + Intronic
1004955993 6:20728462-20728484 CACTCTTCTTTTTCTTTTGTGGG - Intronic
1005756034 6:28925679-28925701 CCTTCATCTTCTCCTTTACTTGG + Intergenic
1006208628 6:32373485-32373507 CCTTCCTCTTTTTCTTCTTTTGG - Intergenic
1006253616 6:32811733-32811755 GGTTCATCTTGTTCATTTCTTGG - Intergenic
1006665885 6:35692927-35692949 CCTTTTTCTTCTTTCTTTCTGGG + Intronic
1006721431 6:36154687-36154709 CCTTCTGCTTGTTTCTTGCTGGG - Intergenic
1006998087 6:38282432-38282454 CCTCCTGCTGTTTCTTTTCTAGG + Intronic
1007435445 6:41807028-41807050 TCTTTTTCTTTTTCTTTTTTGGG - Intronic
1007887427 6:45246657-45246679 CCTTCCTTTTGTTGATTTCTAGG - Intronic
1008057911 6:46964164-46964186 CCTCCTTCTTCCTCTCTTCTGGG + Intergenic
1008384869 6:50877315-50877337 CCTCCTTCTTCCTCTTTGCTTGG + Intergenic
1008914114 6:56768244-56768266 CATTCAACTTGTTATTTTCTGGG - Intronic
1009262506 6:61511767-61511789 CTTCCTTCTAGTTCTTTTCTTGG - Intergenic
1009279845 6:61734731-61734753 CATTCATCTTATTATTTTCTTGG + Intronic
1009472467 6:64044654-64044676 CATTCTTTCTGTTCTTTTCAGGG + Intronic
1009563322 6:65276404-65276426 TCTTTTTTTTTTTCTTTTCTGGG - Intronic
1009956995 6:70467579-70467601 CCTTTTTCCCGTTCTCTTCTTGG + Intronic
1010172053 6:72986396-72986418 TCTTCTTCTTTTTCTTCTCTGGG - Intronic
1010267927 6:73887814-73887836 TCTTTTTCTTTTTCTTTTATGGG + Intergenic
1010295182 6:74187299-74187321 TCTTATTGTTGTTATTTTCTGGG + Intergenic
1010501007 6:76600423-76600445 ACTTCTTATTGGTCTTTTCAGGG - Intergenic
1011142262 6:84171661-84171683 CATTTTTCTTGTTTTGTTCTTGG + Exonic
1011253321 6:85395791-85395813 TCTTTATCTTTTTCTTTTCTTGG + Intergenic
1011632278 6:89339429-89339451 CCTCTTTTTTTTTCTTTTCTTGG - Intronic
1011682205 6:89794038-89794060 CTTTTTTTTTTTTCTTTTCTGGG - Intronic
1011882948 6:92053481-92053503 CCTGCTTCTTTTTCTTCTCCAGG - Intergenic
1012190861 6:96277832-96277854 TCTTTTTCTTTTTCTTTTTTTGG + Intergenic
1012251119 6:96982307-96982329 CCTTCTTTGTCTTCTTTTATTGG + Intronic
1012320689 6:97841147-97841169 CCTTTTTCTTAATATTTTCTTGG + Intergenic
1012439131 6:99246006-99246028 TCTTCTTCTTTTTTTTTTTTGGG - Intergenic
1012615633 6:101275979-101276001 CTATCTTCTTCTTCTTTTTTTGG + Intergenic
1013224541 6:108111045-108111067 TCTTTTTCTTTTTCTTTTTTTGG - Intronic
1013241066 6:108246205-108246227 CCTACTGCTTGTTTTTTGCTAGG + Intronic
1013896469 6:115094460-115094482 CCATTAACTTGTTCTTTTCTAGG - Intergenic
1014283305 6:119465859-119465881 CCTTGTTTTTGTTGTTTTCTGGG - Intergenic
1014490360 6:122054834-122054856 CTTCCTCCTTGTTCTTTTCCTGG + Intergenic
1014794493 6:125708506-125708528 TCTTCTTTTTTTTCTTTTTTAGG - Intergenic
1014807358 6:125845215-125845237 CCTTCTCTTGGTTCTTTTCTTGG - Intronic
1015748281 6:136534324-136534346 CCTCCTTCTTCTTCTTTCCCAGG + Intronic
1015850687 6:137568791-137568813 CCTTCTCCTCCTCCTTTTCTGGG - Intergenic
1016829922 6:148424225-148424247 TCTTCTTCTTTTTTTTTTTTGGG + Intronic
1016855577 6:148667018-148667040 CCTTCTTTCTCTTCTTTTGTGGG + Intergenic
1017146188 6:151237968-151237990 TCTTCTTCTTTTTTTTTTTTTGG + Intergenic
1017159322 6:151350454-151350476 CCCTCTCCTTGCTCTTTTCTTGG - Exonic
1017211562 6:151862684-151862706 CCTGCTGCTTGTTCTTTGCTGGG + Intronic
1017297650 6:152817528-152817550 CCTTCTTCCCTTTCTCTTCTGGG + Intergenic
1017384171 6:153863214-153863236 CCTTCTGCTTTTGCTTGTCTAGG - Intergenic
1018623774 6:165757273-165757295 TCTTTTTCTTGTTGGTTTCTGGG + Intronic
1019099435 6:169616486-169616508 TCTTCTTCTTCTTATTTTTTTGG - Intronic
1019156933 6:170045502-170045524 CCTTCTTCTTTTGCTGTCCTGGG - Intergenic
1019969963 7:4532795-4532817 TCTTTTTCTTTTTTTTTTCTTGG - Intergenic
1020398458 7:7745859-7745881 CCTTATTCTTGTCTTTTCCTGGG + Intronic
1020754317 7:12182662-12182684 ACTTCTTCTTGGTTTTGTCTTGG - Intergenic
1020969401 7:14915586-14915608 TCTTATTCTTGTTCTTCTATAGG - Intronic
1020992750 7:15221057-15221079 CCTCTTTCTCCTTCTTTTCTTGG - Intronic
1021219570 7:17960763-17960785 TCTTCTTCTTCTTCTTTTTTTGG - Intergenic
1021866236 7:24961356-24961378 GCTTCTTCTTGTTAATTTCAAGG - Intronic
1021905001 7:25324334-25324356 CCTTCAGCTTGGCCTTTTCTTGG + Intergenic
1022158816 7:27687983-27688005 CCTCCCTCTTATTTTTTTCTTGG + Intergenic
1022367500 7:29738441-29738463 CTTTCTTCTTTTTCTATTATAGG - Intergenic
1022671508 7:32460515-32460537 TTTTCTTTTTTTTCTTTTCTTGG - Intergenic
1022757899 7:33313710-33313732 CATTTTACTTGTCCTTTTCTTGG + Intronic
1022797468 7:33743481-33743503 CCTTATTCTGCTTCCTTTCTTGG + Intergenic
1022844821 7:34199548-34199570 CCTTTTTTTTTTTTTTTTCTGGG + Intergenic
1022928685 7:35085430-35085452 CTTTCTTCTTTTTCTATTATGGG + Intergenic
1022985874 7:35652810-35652832 CCTTCAGCTTTTTCTTGTCTGGG - Intronic
1023711236 7:42995127-42995149 CCTCCTTCTTATTTTTTTTTAGG + Intergenic
1024009227 7:45253655-45253677 CGTTCCTCTGTTTCTTTTCTGGG + Intergenic
1024347242 7:48325544-48325566 TTTTCTTTTTGTTCTTTTCATGG + Intronic
1024453138 7:49571979-49572001 GCTTCTTCTAGATCATTTCTAGG - Intergenic
1024832132 7:53473331-53473353 CATTCTTGTGATTCTTTTCTTGG + Intergenic
1024859838 7:53825847-53825869 ACTTGTTATTGTTCTATTCTGGG - Intergenic
1024869605 7:53947650-53947672 GCTTCTTCTGGCTATTTTCTTGG - Intergenic
1024914592 7:54485009-54485031 CTTTCTCCTTGTTCTCTCCTAGG + Intergenic
1025524785 7:61791471-61791493 CTTTCTTCTAGTTTTTTTCCTGG + Intergenic
1025534870 7:61935142-61935164 CCTCCTTCTTGGTCTTTTTCAGG - Intergenic
1025536278 7:61952126-61952148 CTTTCTTCTAGTTTTTATCTTGG + Intergenic
1025550853 7:62246752-62246774 CTTTCTTCTTGTTTTTGTCCTGG - Intergenic
1025580454 7:62708593-62708615 CTTTCTTCTAGTTTTTTTCCTGG + Intergenic
1025580748 7:62712916-62712938 CTTTCTTCTAGTTTTTTCCTGGG + Intergenic
1025583836 7:62755796-62755818 CCTTCTTCCAGTTTTTATCTTGG - Intergenic
1025586133 7:62790185-62790207 CTTCCTTCTTGTTTTTTACTTGG - Intergenic
1025589698 7:62841627-62841649 CTTCCTTCTTGTTTTTTTCCTGG - Intergenic
1025600481 7:62991189-62991211 CTTCCTTCTTATTTTTTTCTTGG - Intergenic
1025720728 7:64009948-64009970 ACTTCTTCTTGTTTTAGTCTTGG + Intergenic
1026484277 7:70804562-70804584 CCTTTTTTTTTTTCTTTTTTTGG - Intergenic
1026774400 7:73222345-73222367 TCTTTTTCTTTTTCTTTTTTTGG + Intergenic
1026902955 7:74047082-74047104 TTTTCTTCTTTTTCTTTTTTTGG - Intronic
1027015257 7:74775731-74775753 TCTTTTTCTTTTTCTTTTTTTGG + Intronic
1027072774 7:75170222-75170244 TCTTTTTCTTTTTCTTTTTTTGG - Intergenic
1027352871 7:77329374-77329396 CCTTCTTTTTCCTGTTTTCTAGG + Exonic
1027764672 7:82324352-82324374 CCTTCTTCTTTTTTTTTTTTTGG - Intronic
1028063956 7:86357802-86357824 CCTTATTCTTGATCTCTTCGTGG - Intergenic
1028275160 7:88846625-88846647 CATTCTTCCTGTTCCTTCCTGGG - Intronic
1028823183 7:95236729-95236751 CTTTCTTCTTTTTTTCTTCTTGG + Intronic
1029020057 7:97355960-97355982 CAAGCTTCTTGTTATTTTCTTGG + Intergenic
1029083866 7:97996379-97996401 TCTTCCTCCTGTTCTTTCCTGGG - Intergenic
1029548419 7:101223472-101223494 TTTTCTTCTTTTTCTTTCCTAGG - Exonic
1029824796 7:103179110-103179132 CTTTCTTCTTTTTCTATTATGGG + Intergenic
1030285541 7:107823237-107823259 CCTTATTTATGTTCTTTTTTGGG + Intergenic
1030335167 7:108317906-108317928 CTTTCTTTTTTTTTTTTTCTGGG - Intronic
1030452384 7:109729589-109729611 CCTTCTTCTGGCTCTTTTATAGG - Intergenic
1030686795 7:112495214-112495236 CCTAATTCTTCTTCATTTCTTGG + Intergenic
1031430001 7:121656560-121656582 TCTTCTTCTTTTTTTTTTTTAGG - Intergenic
1032557116 7:132847968-132847990 CAATCGTCTTGTTCTTTTCTGGG - Intronic
1032677310 7:134143006-134143028 CCTTTGTCTTGTTATTTTATTGG + Intronic
1033188050 7:139247836-139247858 CCTTCCACTTGTCCTTGTCTGGG + Intronic
1033669276 7:143475496-143475518 CATTCTGCTGGTTGTTTTCTTGG - Intergenic
1033852116 7:145510033-145510055 CTTTCTACTTATTGTTTTCTAGG + Intergenic
1033950222 7:146775657-146775679 TCTTCTTCTTGTTCTTCTTTTGG - Intronic
1034465510 7:151226370-151226392 TTTTCTTCATGTCCTTTTCTGGG + Exonic
1034979009 7:155463897-155463919 CCTTTATTTTTTTCTTTTCTTGG + Exonic
1035341497 7:158165434-158165456 CTTTCTCCTTGTTCCTCTCTTGG - Intronic
1035400546 7:158562426-158562448 CCCTCTTCCTGTTCTGGTCTGGG - Intronic
1035562329 8:615241-615263 CTTTCCTCTTCTTATTTTCTTGG + Intronic
1035756657 8:2037860-2037882 CCTTTTTTTTTTTCTTTGCTGGG + Intergenic
1035877081 8:3202854-3202876 CCTTCTTTGTGTTTTTCTCTGGG - Intronic
1035899199 8:3439153-3439175 TCTTTTTCTTTTTTTTTTCTTGG - Intronic
1036160328 8:6381592-6381614 CCATCTTCATTTTCTCTTCTGGG - Intergenic
1036448145 8:8841482-8841504 ACTTCTTTTTGTTGTTTGCTGGG + Intronic
1036975448 8:13406002-13406024 TCTTCTTCTTTTTTTTTTTTTGG + Intronic
1037146201 8:15576249-15576271 CTTTCTTTTTTTTTTTTTCTTGG + Intronic
1037202749 8:16277971-16277993 TCTTATTCTTGTTCTTCTTTTGG + Intronic
1037977231 8:23222578-23222600 CCTTCTTCCTGTGCATTTATAGG - Intronic
1038343328 8:26708093-26708115 TCTTCTGCTTGTTCTTTAATAGG - Intergenic
1038476731 8:27873703-27873725 CTTTCTTTTTTTTCTTTTTTTGG - Intronic
1038833304 8:31087854-31087876 TCTTCTTCTTCTTCTTTAGTAGG - Exonic
1038968796 8:32607933-32607955 CCTTCTTTTTATTCTCTTCTTGG + Intronic
1039017024 8:33161293-33161315 TGTTCTTTTTGTTCTTTTGTTGG - Intergenic
1039542556 8:38383177-38383199 TCTTCCTCTCGTTCTTATCTTGG - Intergenic
1039724287 8:40198566-40198588 CCTTGTCCTTGTTCTCTCCTGGG - Intergenic
1039729965 8:40263722-40263744 ACAACTTCTTGTTTTTTTCTAGG - Intergenic
1040119340 8:43664435-43664457 CTTTTTTCTTTTTTTTTTCTGGG - Intergenic
1040124272 8:43719116-43719138 CTTTCTTCTAGTTTTTGTCTGGG - Intergenic
1040133658 8:43827237-43827259 CCTCTTTCTTGTTTTTATCTGGG - Intergenic
1040134852 8:43841121-43841143 CTTCTTTCTTGTTCTTCTCTGGG - Intergenic
1040138915 8:43887513-43887535 CTTCCTTCTAGTTTTTTTCTGGG - Intergenic
1040783099 8:51134188-51134210 CTTTTTTCTTCTTTTTTTCTTGG - Intergenic
1040895096 8:52358821-52358843 CCTTCTTCTTCTATTTTTTTTGG - Intronic
1040938260 8:52804314-52804336 CCTTATTCTTTTTACTTTCTTGG + Intergenic
1040997050 8:53412908-53412930 CCTTTATGTTTTTCTTTTCTAGG - Intergenic
1041221840 8:55659580-55659602 ACTTCTTCTTGTTTTAGTCTTGG - Intergenic
1041389706 8:57337742-57337764 CCTGCCTCTTGTTCTCATCTGGG + Intergenic
1041580526 8:59454444-59454466 TTTTCTTCTTGTTTTCTTCTAGG + Intergenic
1041800836 8:61796477-61796499 CCTTTTTTTTTTTTTTTTCTAGG + Intergenic
1041899602 8:62966883-62966905 TTTTCTTCTTGTTCTTCTTTCGG + Intronic
1041904373 8:63015640-63015662 TCTTCTTCTTTTTTTTTTTTTGG - Intronic
1042077380 8:65011157-65011179 CCTTCTTCCTTTTTCTTTCTTGG + Intergenic
1042172807 8:66008864-66008886 CCTTTTTTTTTTTCTTTTTTGGG + Intergenic
1042360640 8:67878694-67878716 TCTTCTTCTTTTTTTTTTTTTGG - Intergenic
1043030219 8:75124935-75124957 CCTTTTTGTTGTTGTTTTCTGGG - Intergenic
1043070680 8:75631953-75631975 TCTTTTTCTTTTTCTTTTTTTGG + Intergenic
1043128626 8:76432777-76432799 CCTTCTTTTGGTTTTCTTCTTGG - Intergenic
1043416370 8:80054740-80054762 TCTTCTTTTTTTTTTTTTCTTGG - Intronic
1044078473 8:87854685-87854707 CCTTCTTCTTGCCCTTCCCTGGG - Intergenic
1044811694 8:96070144-96070166 CTTTTTTCTTTTTCTTTGCTTGG + Intergenic
1044942960 8:97361877-97361899 CCTTCCTCTTCTGCTTTTCAGGG - Intergenic
1045059807 8:98401944-98401966 CTTTCTTCTTTTATTTTTCTGGG - Intronic
1045593882 8:103630775-103630797 CTTTTTTCCTGTTCTTTTGTGGG - Intronic
1045771626 8:105747596-105747618 CTTCCTTCTTGTTCTTCTTTGGG + Intronic
1045860818 8:106813355-106813377 AATTGTTTTTGTTCTTTTCTAGG + Intergenic
1046979380 8:120319970-120319992 TCTCCTTCCTCTTCTTTTCTTGG + Intronic
1047018486 8:120749144-120749166 ACGTCTTCTCGTTCTTTTCCAGG - Intronic
1047028931 8:120854712-120854734 CTTTCTTCCTGATCTTTACTAGG - Intergenic
1047088975 8:121552489-121552511 CCTGCTTCTTACTCTTTTTTGGG - Intergenic
1047115142 8:121833560-121833582 TCTTCCTCTCTTTCTTTTCTTGG - Intergenic
1047342147 8:123992586-123992608 CTTCCATCTTCTTCTTTTCTTGG + Intronic
1047568470 8:126072628-126072650 TCTTCTTCTTTTTCTTCTCTGGG - Intergenic
1047585886 8:126271920-126271942 TTTTCTTCATTTTCTTTTCTTGG + Intergenic
1047624092 8:126637747-126637769 CATTCTTCATGCTTTTTTCTTGG - Intergenic
1047625848 8:126655311-126655333 TCTTCCTCTTTTTTTTTTCTTGG - Intergenic
1047713862 8:127577619-127577641 GCTTCTCCTTTTTTTTTTCTTGG + Intergenic
1047864624 8:129008686-129008708 TCTTCTTCTTCTTTTTTTTTGGG - Intergenic
1047936011 8:129779277-129779299 TCTTGATCTTGTTCTTTTTTTGG - Intronic
1047954491 8:129963036-129963058 CTTTCTGATTGGTCTTTTCTGGG - Intronic
1050000141 9:1068866-1068888 ACTTCTTCTTGTTTTAGTCTTGG + Intergenic
1050271733 9:3953061-3953083 ACCACTTCTTGTTTTTTTCTGGG + Intronic
1050380986 9:5029761-5029783 CCTTTCTCTGCTTCTTTTCTAGG + Exonic
1050526893 9:6553986-6554008 CTTTCTTGTTTTTTTTTTCTTGG - Intronic
1051037327 9:12764129-12764151 ACTTCATCTAGTTCTTTTCAGGG + Intergenic
1051040674 9:12806381-12806403 TCTTTTTTTTTTTCTTTTCTGGG + Intronic
1051172665 9:14334533-14334555 CCTTTTTCTTGTTGATTTGTAGG + Intronic
1051231686 9:14961838-14961860 CCTTCTTCCTTTGCTTTGCTGGG + Intergenic
1051354191 9:16226217-16226239 CCTTCATTTTGTTATTTACTTGG - Intronic
1051612275 9:18972793-18972815 CCTACATCTTGTTCTCTTCTTGG + Intronic
1051933407 9:22413814-22413836 TCTTCTTCTTCTTTTTTTTTTGG - Intergenic
1051949971 9:22619727-22619749 CCTTCTTACTGTTTTTTTCTTGG - Intergenic
1052159707 9:25242424-25242446 CTTTCTTCTTTTTCTTTTTTTGG + Intergenic
1052595766 9:30556635-30556657 CCTTGTTCTTGTTAGTTTCTTGG - Intergenic
1052636447 9:31112173-31112195 CCCTCTTCTCTTTCTTTTATTGG + Intergenic
1053206421 9:36190463-36190485 TCTTCTTCTTCTTTTTTTTTAGG + Intergenic
1053242340 9:36506329-36506351 CCTTCTTCTTCTTCTCTTAATGG + Intergenic
1053820133 9:41958104-41958126 CTTTTTTCTTTTTCTTTTTTTGG + Intronic
1054110407 9:61101785-61101807 CTTTTTTCTTTTTCTTTTTTTGG + Intergenic
1054610450 9:67229340-67229362 CTTTTTTCTTTTTCTTTTTTTGG - Intergenic
1054726690 9:68659301-68659323 ACTTCTTCTTATCCTTTCCTAGG - Intergenic
1055028175 9:71744545-71744567 TCTTTTTCTTTTTCTTTTTTCGG - Intronic
1055033270 9:71792032-71792054 CCTTTTTTTTTTTCTTTTCCTGG - Intronic
1055093957 9:72390945-72390967 CATACGTCTTCTTCTTTTCTTGG - Intergenic
1055172153 9:73271771-73271793 CTTTTGTCTTATTCTTTTCTTGG + Intergenic
1055371712 9:75606754-75606776 CCTTGTTCTTGGACTATTCTTGG + Intergenic
1055639580 9:78309114-78309136 TTTTCCTCTTGTTCTTTTCTGGG + Intronic
1055728145 9:79253645-79253667 CATTCTTATTTTTCTTTTCTTGG + Intergenic
1055969589 9:81898564-81898586 TTTTTTTCTTTTTCTTTTCTTGG + Intergenic
1056512910 9:87322465-87322487 TCTTTTTCTTTTTCTTTTTTTGG + Intergenic
1056720878 9:89070849-89070871 CCTACTTTTTGTTTTTTTATTGG - Intronic
1057043119 9:91862021-91862043 CCTTCTTCTTCTTCTTATAAGGG - Intronic
1057070544 9:92095709-92095731 CTTTCTCCTTGTTCTGGTCTGGG - Intronic
1057435508 9:95036695-95036717 TCTTCTTCTTTTTTTTTTGTGGG + Intronic
1057499285 9:95584186-95584208 CCTTCTTCCTGTCCATCTCTGGG + Intergenic
1057527746 9:95817553-95817575 CTTTCTTCTTTTTCTTTTCTTGG + Intergenic
1058130443 9:101246778-101246800 CCGTTTTCCTGTTCTTGTCTGGG + Intronic
1058282332 9:103131363-103131385 CTTTCTGGTTTTTCTTTTCTTGG - Intergenic
1058473316 9:105303680-105303702 CCTTCTACCTCTTCTCTTCTGGG - Intronic
1058618085 9:106857113-106857135 TCTTATTCTTTTTCTTTTTTTGG - Intergenic
1059578050 9:115513107-115513129 CCTTCTCCTTTTTCTTTTTTTGG + Intergenic
1060254597 9:122016032-122016054 CCTTGTTGTTTTTCTTTTCATGG - Intronic
1060563226 9:124565620-124565642 CCTTTTTCTTATTCTTATATAGG - Intronic
1061041472 9:128143357-128143379 CCTAATGCCTGTTCTTTTCTTGG + Intergenic
1061354276 9:130092327-130092349 CCTTTTTCTTCTTTCTTTCTGGG + Exonic
1061447558 9:130649391-130649413 TCTTCTTCTTTTTTTTTTTTTGG - Intergenic
1061483341 9:130908087-130908109 GCTTTTTCTTTTTCTTTTGTGGG - Intronic
1062131963 9:134900989-134901011 CCTTCTCCTTCTTCTTCTGTAGG - Intergenic
1062219043 9:135404486-135404508 CCTTCTGGTTGTGTTTTTCTGGG - Intergenic
1062642906 9:137530419-137530441 CCTTCTTCTGGTGCTTTTGGAGG + Intronic
1203367670 Un_KI270442v1:272879-272901 CCTTCCCCTTGTCCTCTTCTAGG + Intergenic
1203650127 Un_KI270751v1:109876-109898 TCTTGTGCTTGTTGTTTTCTTGG + Intergenic
1185587755 X:1253090-1253112 CCATCTCCTTGTTCCTTGCTGGG - Intergenic
1185587811 X:1253467-1253489 CCATCTGCTTGTTCCTTGCTGGG - Intergenic
1185587867 X:1253844-1253866 CCATCTGCTTGTTCCTTGCTGGG - Intergenic
1186228558 X:7428088-7428110 ATTTCTTCTCTTTCTTTTCTGGG - Intergenic
1186698275 X:12061211-12061233 CCTTATTCTTGTGTTTTTCCTGG - Intergenic
1186778737 X:12891999-12892021 CCTTCTTTTTTTTTTTTTTTTGG - Intergenic
1187041515 X:15601029-15601051 TCTTCTTCTTTTTCTTTTTTTGG - Intronic
1187286817 X:17913496-17913518 TCTTCTTTTTGTTTTTCTCTTGG - Intergenic
1187636281 X:21232319-21232341 ACTTCTTCTTTTGCTTCTCTAGG - Intergenic
1187742541 X:22372213-22372235 CCTTCTTGTTGTGATTTACTTGG - Intergenic
1187773954 X:22733815-22733837 CATTATTCTTGTTGATTTCTAGG - Intergenic
1187973549 X:24682689-24682711 TCTTCTTCTTCTTCTTTTATTGG - Intergenic
1188195573 X:27228648-27228670 TCTTGTTCTCATTCTTTTCTAGG + Intergenic
1188599799 X:31947867-31947889 CCTTCTTCTTCTTCTTCTTATGG + Intronic
1188626654 X:32293410-32293432 CCTCCTTCTGGTTCTCTTCCTGG - Intronic
1188792521 X:34421428-34421450 CTTTCTTACTGTTCTTTTCAGGG - Intergenic
1189261734 X:39684023-39684045 CCCTCTTCCTTTTCTTTTCTAGG + Intergenic
1189529365 X:41863456-41863478 ACTTTTTCTTTTTCCTTTCTGGG - Intronic
1189544846 X:42031630-42031652 CCTACTTTTTGTGCTTTTATTGG + Intergenic
1189708349 X:43782454-43782476 ACTTGTTCTTGTTCTATTCAGGG - Intronic
1190374562 X:49776175-49776197 CCTCCTTCTTCTTCTTCTCCTGG + Intergenic
1190722881 X:53165077-53165099 CCTTTATGTTTTTCTTTTCTTGG + Intergenic
1190976828 X:55412273-55412295 GTTTCCTCTTGTTCTTTTATTGG - Intergenic
1191264176 X:58366686-58366708 CTTTCTTCTAGTTTTTATCTTGG + Intergenic
1191582017 X:62773581-62773603 CCTTTTTCTAGTTTTTATCTGGG + Intergenic
1191834429 X:65448811-65448833 CTTTCTTTTTCTTCTTTTTTTGG - Intronic
1191863166 X:65682508-65682530 CCTTCTTCGTGTTGATTTATAGG - Intronic
1192141487 X:68650418-68650440 CCTCCTTCTTCTTCTTCTATAGG - Intronic
1192257198 X:69471688-69471710 CATTCTTCTTTTTCTTCTCCTGG + Intergenic
1192311879 X:70023219-70023241 CCTTTTTCTTGTTTTTAACTGGG - Exonic
1192346383 X:70311122-70311144 TCTTCTTCTTTTTTTTTTTTAGG - Intronic
1192810133 X:74539976-74539998 CTTTTTTCTTTTTCTTTTTTGGG - Intergenic
1193102970 X:77636761-77636783 CTTTCTTCTTTTTTTTTTTTTGG - Intronic
1193603659 X:83539876-83539898 CATTCTTTTTTTTCTTTTCCTGG - Intergenic
1193799870 X:85922312-85922334 CCTTTTTTTTCTTCCTTTCTTGG + Intronic
1193950693 X:87794437-87794459 CCTTATTCTTGATCTGTTCAGGG + Intergenic
1194671961 X:96744863-96744885 CCTTCTTCTGGGTCTTTTGATGG + Intronic
1194959989 X:100224056-100224078 CCTTTTTCTCCTCCTTTTCTGGG + Intergenic
1195036423 X:100974105-100974127 CATTTTTCTTTTTCATTTCTAGG + Exonic
1195361999 X:104091575-104091597 CCTCATTCGTGTTCTTTTCAGGG - Intergenic
1195369762 X:104161845-104161867 TCTTCTTCTTCTTTTTTTTTTGG - Intergenic
1195449147 X:104990499-104990521 GCTTCTTCTTCTTCTTTACAAGG + Intronic
1195741279 X:108067147-108067169 TTTTCTGCTTTTTCTTTTCTTGG + Intronic
1195864839 X:109420219-109420241 TCTTCTTCTTTTTTTTTTTTTGG - Intronic
1195867904 X:109453191-109453213 CCTTCTTCTTGCTCTTTTGTAGG - Intronic
1196146096 X:112318640-112318662 GCTTCTTCTTATTCTTTACATGG + Intergenic
1196210451 X:112990234-112990256 CTTTCTTCTTTTTCTTTTTTTGG + Intergenic
1196246722 X:113408541-113408563 CCTTCCTCTTCTTTATTTCTTGG + Intergenic
1196811228 X:119630544-119630566 TATTCTTCTTGTTCTTCTTTGGG - Intronic
1197479685 X:126966840-126966862 CCTTTATGTTTTTCTTTTCTTGG + Intergenic
1197509331 X:127351434-127351456 CCTTTATGTTTTTCTTTTCTTGG + Intergenic
1197699668 X:129589343-129589365 CTTTCTTCTTTTTCTCTTCTTGG + Intronic
1197757723 X:130007879-130007901 CCTACTTCCTGCTCCTTTCTTGG - Intronic
1197904803 X:131413327-131413349 TCTTCTTCTTCTTCTTTTGAAGG - Intergenic
1198031407 X:132756905-132756927 CCTTGTTCTTGTTCTGCTCTGGG - Intronic
1198619752 X:138493090-138493112 CCTTATCTTTGTTCTTTTGTAGG + Intergenic
1198939373 X:141936006-141936028 CCTTTATGTTTTTCTTTTCTTGG + Intergenic
1199584346 X:149397949-149397971 ACTTCTTAATGTTCTTTTTTGGG + Intergenic
1199829701 X:151537429-151537451 CCTTTATGTTTTTCTTTTCTTGG - Intergenic
1200283036 X:154794708-154794730 TCATCTTCTAGTCCTTTTCTAGG - Intronic
1200689991 Y:6297620-6297642 CCCTCTTCTTTTTTTTTTTTTGG - Intergenic
1200823797 Y:7618455-7618477 CCTTTGTCTTATTCTTTACTGGG + Intergenic
1201045282 Y:9877100-9877122 CCCTCTTCTTTTTTTTTTTTTGG + Intergenic
1201386520 Y:13445762-13445784 CCTTCTTCTGGTTTTTTTCAAGG + Intronic
1201992102 Y:20038468-20038490 ACTTCTTCTTTTTTTTTTTTTGG - Intergenic
1202236259 Y:22712633-22712655 CCTTTGTCTTATTCTTTACTGGG - Intergenic
1202305800 Y:23469258-23469280 CCTTCTTCTCTTTACTTTCTTGG + Intergenic
1202306906 Y:23483535-23483557 CCTTTGTCTTATTCTTTACTGGG + Intergenic
1202563901 Y:26187051-26187073 CCTTTGTCTTATTCTTTACTGGG - Intergenic
1202565009 Y:26201331-26201353 CCTTCTTCTCTTTACTTTCTTGG - Intergenic