ID: 936382405

View in Genome Browser
Species Human (GRCh38)
Location 2:111998072-111998094
Sequence ATGTTCTAGTAGCATTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936382405_936382413 15 Left 936382405 2:111998072-111998094 CCTTCAGAATGCTACTAGAACAT 0: 1
1: 0
2: 0
3: 15
4: 166
Right 936382413 2:111998110-111998132 ACTTGCCATAGGCGTGGGAAGGG 0: 1
1: 0
2: 0
3: 9
4: 81
936382405_936382411 10 Left 936382405 2:111998072-111998094 CCTTCAGAATGCTACTAGAACAT 0: 1
1: 0
2: 0
3: 15
4: 166
Right 936382411 2:111998105-111998127 CCAAGACTTGCCATAGGCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 53
936382405_936382412 14 Left 936382405 2:111998072-111998094 CCTTCAGAATGCTACTAGAACAT 0: 1
1: 0
2: 0
3: 15
4: 166
Right 936382412 2:111998109-111998131 GACTTGCCATAGGCGTGGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 68
936382405_936382409 9 Left 936382405 2:111998072-111998094 CCTTCAGAATGCTACTAGAACAT 0: 1
1: 0
2: 0
3: 15
4: 166
Right 936382409 2:111998104-111998126 TCCAAGACTTGCCATAGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 58
936382405_936382408 4 Left 936382405 2:111998072-111998094 CCTTCAGAATGCTACTAGAACAT 0: 1
1: 0
2: 0
3: 15
4: 166
Right 936382408 2:111998099-111998121 CTCGCTCCAAGACTTGCCATAGG 0: 1
1: 0
2: 0
3: 4
4: 64
936382405_936382415 26 Left 936382405 2:111998072-111998094 CCTTCAGAATGCTACTAGAACAT 0: 1
1: 0
2: 0
3: 15
4: 166
Right 936382415 2:111998121-111998143 GCGTGGGAAGGGCTTAAGATTGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936382405 Original CRISPR ATGTTCTAGTAGCATTCTGA AGG (reversed) Intronic
906971658 1:50520902-50520924 ATGATCTAGAAGAATTCAGAAGG - Intronic
908748009 1:67394450-67394472 ATTTTCTCTTAGCATTCTGCCGG - Intronic
909098663 1:71322503-71322525 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
909507472 1:76409933-76409955 ATGTTCTGGAAATATTCTGAAGG - Intronic
911689488 1:100816267-100816289 CAGTTCTAGTAGCTTTCTGGAGG - Intergenic
912483599 1:110005606-110005628 ATGTTGTAGTGGAATTCTGGTGG + Intronic
914456212 1:147838833-147838855 CTATTCTAGTAGCCTTCTAACGG - Intergenic
914968321 1:152281758-152281780 TAGTTCTAGGAGCATTCTGGAGG - Intergenic
916238318 1:162613107-162613129 ATATTCTCGTAACATACTGAAGG + Intergenic
917836885 1:178948143-178948165 ATGGACTAGAAGCATTTTGAGGG - Intergenic
922658288 1:227405335-227405357 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
924357322 1:243194697-243194719 ATGTTCTGTTAGTGTTCTGAGGG - Intronic
1067246672 10:44553243-44553265 ATGTTCCAGTGACATTCTGATGG + Intergenic
1067422488 10:46166754-46166776 TAGCTCTAGTAGCTTTCTGATGG + Intergenic
1071295730 10:84217928-84217950 CTTTTCTAGCAGGATTCTGAGGG - Intronic
1071843805 10:89500902-89500924 CAGTTCTAGGAGCTTTCTGAAGG - Intronic
1072829762 10:98645408-98645430 ATATTTTAGAAGCATTTTGAAGG - Intronic
1075385741 10:122054114-122054136 ATGTTCTAGCATAATTCAGAGGG - Intronic
1075535505 10:123268889-123268911 ATTTTCTAGTCCCATTTTGATGG + Intergenic
1078538430 11:12193784-12193806 ATGCTCAAGTAGCATGCTCAAGG - Intronic
1080671519 11:34383740-34383762 ATGTACTAGTAAGAATCTGATGG - Intergenic
1081200408 11:40208052-40208074 ATGTTCTAGAAAGCTTCTGAAGG - Intronic
1081497406 11:43629402-43629424 ATGTAATAGTAGCTCTCTGAAGG - Intronic
1082722767 11:56698645-56698667 ATGTTCTAGATGCATTTTGAAGG + Intergenic
1087296660 11:96385194-96385216 GTGATCTAATAGCATTCTGAAGG + Intronic
1093408862 12:18841134-18841156 CAGTTCTAGGAGCTTTCTGAAGG + Intergenic
1093425955 12:19029240-19029262 ATGTTCCAGTTCCAATCTGAAGG - Intergenic
1093501641 12:19819294-19819316 AAGTACTAGTATCATTCTCATGG + Intergenic
1094868490 12:34570006-34570028 CTGTTCTTGTAGAATTATGAAGG - Intergenic
1098941842 12:76546498-76546520 ATTTTCTAGCAGCATTATTAAGG + Intronic
1099043905 12:77692311-77692333 ATTTTATAATAGCATTTTGAAGG + Intergenic
1104147113 12:126045355-126045377 AAGTTCTAGGAGCTTTCTGGAGG - Intergenic
1106015799 13:25867845-25867867 AGGCTATAGTAGGATTCTGAGGG - Intronic
1107585609 13:41844601-41844623 CTGTTCTAGCAGCATTTTGAGGG - Intronic
1108427469 13:50318545-50318567 ACCTTCTAGTAACATTTTGAGGG - Intronic
1110298138 13:73893967-73893989 TTGTTCTAGTTCCTTTCTGATGG - Intronic
1110998244 13:82140962-82140984 ATGTTCTATTAACATTCTGTAGG + Intergenic
1111840384 13:93442246-93442268 ATTTTCTAGCAGCATTGTGCAGG + Intronic
1112202925 13:97295002-97295024 ATGTTATGGTATCATTGTGAGGG + Intronic
1115213330 14:30990135-30990157 GTGTTCTAGCAGTCTTCTGAGGG + Intronic
1115419581 14:33178701-33178723 ATGCTCTAGTAGTTTTCTTATGG + Intronic
1117334397 14:54744575-54744597 AAGGTCTAGGAGCTTTCTGAAGG + Intronic
1117785560 14:59280981-59281003 AGGTTATATTTGCATTCTGAAGG - Intronic
1118369448 14:65125018-65125040 ATGTTGTAGTGGCATTTTGGGGG + Intergenic
1119559670 14:75579858-75579880 ATGTTCTAGAAGCATGCTTTTGG - Intronic
1124094893 15:26640191-26640213 ACTTTCCAGTAGCATTCAGATGG + Intronic
1124253910 15:28125535-28125557 CTGTTCTAATATTATTCTGATGG - Intronic
1125616405 15:41017723-41017745 ATGGCCTGGCAGCATTCTGAAGG - Intronic
1126123576 15:45274945-45274967 ATGTTCTTGTGGCATTTTGGTGG + Intronic
1127779707 15:62300753-62300775 ATCTTCTAGTACATTTCTGAGGG + Intergenic
1131693405 15:94850449-94850471 ATGTTCTGGCAGCATTTTTAGGG + Intergenic
1134867999 16:17626174-17626196 ATGTTTCAGTAGGATTCTGCTGG - Intergenic
1135997282 16:27260270-27260292 GTGTTCTAATAGCCTTGTGATGG + Intronic
1137931763 16:52595129-52595151 ATTTTCTAATAGAATTTTGAAGG - Intergenic
1139041733 16:63006221-63006243 ATGTTTTAGTAGCATCCTCTTGG - Intergenic
1140908945 16:79434000-79434022 ATGATCTATTAGCATCCTCAGGG + Intergenic
1143002306 17:3802131-3802153 TTGTTCTAGTGGCATTTTAAGGG - Intergenic
1146041087 17:29455355-29455377 ATGTTCTAGTATCTTTCTGTTGG + Intronic
1146452232 17:32983715-32983737 ATGTTGTAGTTCCAGTCTGAAGG + Intronic
1147111623 17:38266495-38266517 ATGTTATAGTAGCATTCCAGAGG - Intergenic
1148417950 17:47522306-47522328 ATGTTATAGTAGCATTCCAGAGG + Intergenic
1149194753 17:54106124-54106146 CAGTTCCAGTAGCATTTTGATGG - Intergenic
1149785582 17:59432018-59432040 ACGTTCTGGAAGCAGTCTGAAGG + Intergenic
1153402228 18:4693604-4693626 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
1154336233 18:13467257-13467279 TTGTTCTAGTAGCTTTCTTGTGG - Intronic
1163199350 19:15753088-15753110 ATGTTTGAGTAGTATTCTGTGGG + Intergenic
1165908631 19:39209824-39209846 ATGTTCAAGTACCACCCTGATGG - Intergenic
1167878563 19:52434928-52434950 ATGTTCCCTTAGCATTCAGAAGG + Intronic
928231346 2:29501139-29501161 ATGTTCTAGAAGGATCCAGAAGG - Intronic
928525810 2:32139379-32139401 CAGTTCTAGTAGCCTTTTGACGG - Intronic
928767563 2:34665635-34665657 ATGTTCTACTAGCTTTGTTAGGG - Intergenic
929369025 2:41198844-41198866 TTGTTCTAGGAGTTTTCTGAAGG - Intergenic
930912106 2:56641402-56641424 ATGACCTAATAGCATACTGAAGG - Intergenic
931324799 2:61208953-61208975 AGATTCTAATAGTATTCTGAAGG + Exonic
931834981 2:66089514-66089536 CAGTTCTAGTAGCTTTCTGGAGG - Intergenic
936382405 2:111998072-111998094 ATGTTCTAGTAGCATTCTGAAGG - Intronic
940707264 2:157120925-157120947 CAGTTCTAGGAGCTTTCTGAAGG + Intergenic
940903702 2:159149552-159149574 AAGTACTGGTAGCATTATGAAGG - Intronic
941188736 2:162349780-162349802 ATGTTCTAATACCATACTAATGG + Intronic
943586449 2:189746613-189746635 ATGTTTTATTAGCCTTCTGCAGG - Exonic
943620973 2:190147887-190147909 TTGTTCTAGGAGCTTTCTGGAGG + Intronic
944284023 2:197927456-197927478 ATGTTCTTCTATCATTTTGAGGG + Intronic
945729244 2:213512981-213513003 AGGTTCCAGAAGCACTCTGAGGG - Intronic
947758739 2:232588093-232588115 ATGTTCTGGAAGCATCCTGATGG - Intergenic
1174253280 20:49235160-49235182 ATGTTCTAATAGAATGCTCAGGG - Intronic
1177879890 21:26680041-26680063 ATGTTGTTGTTGCATTCTTATGG + Intergenic
1178144649 21:29724968-29724990 AGGTTTCAGTAGCTTTCTGAAGG - Intronic
1179083804 21:38198673-38198695 CAGTTCTAGGAGCATTCTGGAGG + Intronic
1181326614 22:22054061-22054083 AGGTTCTTATAGTATTCTGATGG + Intergenic
949959217 3:9298434-9298456 ATGTTCTGGCAGCATTATGTAGG - Intronic
951184142 3:19692609-19692631 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
952601838 3:35092833-35092855 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
954061242 3:48069293-48069315 GTGTCTTACTAGCATTCTGAAGG + Intronic
954285375 3:49615454-49615476 ATGTTGTAGTCCCACTCTGATGG - Intronic
961568364 3:127780322-127780344 ATGTTCTAGAGACATTGTGAAGG - Intronic
962615414 3:137121630-137121652 ATATTATAGTTGCATTCTTAAGG - Intergenic
963549830 3:146705201-146705223 CGTTTCTAGTAGTATTCTGATGG + Intergenic
964733967 3:159897272-159897294 ATGTGCTATTAACATTCTGTTGG + Exonic
971071595 4:23099662-23099684 ATGTTCTAGTGGGTTTATGATGG + Intergenic
972142123 4:35973769-35973791 ATATTCAACAAGCATTCTGATGG + Intronic
972227589 4:37031677-37031699 CTGTTCTGTTAGAATTCTGAAGG - Intergenic
973089799 4:46121544-46121566 ATGTTCTAATAACATTCTCATGG + Intronic
975501777 4:75094484-75094506 GTTTTCTTGTAGCATTTTGAGGG + Intergenic
976793659 4:88908822-88908844 CTGTTTCAGTACCATTCTGATGG - Intronic
976868874 4:89766109-89766131 TTGGTCTAGAATCATTCTGAAGG + Intronic
978395927 4:108279935-108279957 GTGTTAGAGTGGCATTCTGAGGG + Intergenic
979244488 4:118484781-118484803 ATGTTCTGTTAGTGTTCTGAGGG + Intergenic
979435078 4:120678585-120678607 CAGTTCTAGTAGCTTTCTGGAGG - Intergenic
979498804 4:121415200-121415222 CTGTTCTAGGAGCTTTCTGGAGG + Intergenic
979825048 4:125222372-125222394 ATGTTCTAGTAATATTGGGAAGG - Intergenic
980214362 4:129832588-129832610 TTATTTTGGTAGCATTCTGAAGG - Intergenic
982934561 4:161455823-161455845 TTGTTCTGGTAGCCTTCTAAAGG + Intronic
983033873 4:162838152-162838174 ATGCCCTAGAAGCATTCTGGGGG - Intergenic
984324096 4:178229552-178229574 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
986096422 5:4558685-4558707 ACTTTCTAGTAGAATTCTGTAGG - Intergenic
987414125 5:17645156-17645178 TAGTTCTAGGAGCTTTCTGAAGG + Intergenic
989324075 5:40169939-40169961 CTGTTCTAGCAGCCTTTTGATGG - Intergenic
990941943 5:61211253-61211275 ATTCTCTTGTAGCATTCTCAAGG + Intergenic
992031051 5:72721808-72721830 CTGTTTTAGTTGCATTTTGAAGG - Intergenic
993369837 5:87078981-87079003 AGGTTCTGGTAGTATTCTGTAGG - Intergenic
993679206 5:90854356-90854378 ATGGTCTAGTATTGTTCTGATGG + Intronic
995726565 5:115187055-115187077 ATGTTTTTTTACCATTCTGAAGG + Intergenic
996137037 5:119855613-119855635 GTGTTTTAGTAGCATTTTTAGGG + Intergenic
996230668 5:121059767-121059789 ATTTTCTAGTAGCATTATGTAGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998032379 5:138882167-138882189 ATGGTGTGGTAGCATTCTGTGGG + Intronic
999484339 5:151980046-151980068 CTGTTCTAGGAGCTTTCTGGAGG + Intergenic
1001209016 5:169793014-169793036 ATGTCCTAGTAGCTTTCAGAAGG + Intronic
1003256184 6:4476995-4477017 GTGATCTAGTAGCAATCTGATGG - Intergenic
1005250347 6:23938457-23938479 ATGTGCCAGTGACATTCTGAAGG + Intergenic
1005698007 6:28369524-28369546 GTGTTCTAGTTGGAGTCTGAAGG + Intergenic
1006487424 6:34354907-34354929 TTGTTCTAGTAGCTTTTTGGTGG + Intronic
1006759258 6:36444623-36444645 CAGTACTAGTAGCATTATGAGGG + Intronic
1008115863 6:47549313-47549335 CAGTTCTAGGAGCTTTCTGAAGG - Intronic
1008121347 6:47620924-47620946 CAGTTCTAGGAGCTTTCTGAAGG + Intronic
1008929488 6:56923660-56923682 ATGTTCCAGTTGAAATCTGAAGG + Intronic
1009917865 6:70018476-70018498 TTGCTCTACTAGCTTTCTGATGG - Intronic
1010045641 6:71440151-71440173 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
1010181550 6:73092259-73092281 AAGTTCTAGGAGCTTTCTGGAGG + Intronic
1013686845 6:112595024-112595046 ATGACTTAGTAGCTTTCTGATGG + Intergenic
1016836356 6:148480952-148480974 ATTTTCTAATAGCTTTATGATGG + Intronic
1018009814 6:159659871-159659893 AAGTTCTAGGAGCTTTCTGGAGG - Intergenic
1018101363 6:160443984-160444006 ATGTTCAATTAGCATTCTTTGGG + Intronic
1018549941 6:164984114-164984136 AGTTTCTAGTAGCATTCTCCAGG - Intergenic
1020392205 7:7670365-7670387 AAGTTCTTGTAGCACTCTAATGG + Intronic
1021348323 7:19555907-19555929 CTGTTCTAGAAGCCTTCTGGTGG - Intergenic
1023153596 7:37225475-37225497 ATGTTCTTGTTGCATTCTTAAGG + Intronic
1024388291 7:48778674-48778696 ATGTTTTAGTACAAGTCTGAAGG + Intergenic
1024771128 7:52724409-52724431 ATGCTCTAGTATCATTCTCCTGG - Intergenic
1027442768 7:78238055-78238077 ATGTCCTAGTAGCCTTATGAAGG - Intronic
1028130389 7:87165040-87165062 AAGTTCTCCTACCATTCTGAGGG - Exonic
1028961876 7:96758029-96758051 CAGTTCTAGGAGCATTCTGGGGG + Intergenic
1030027543 7:105339610-105339632 GTGTTTTAGTAGTATTCTCAGGG - Intronic
1030390097 7:108917226-108917248 CAGTTCTAGGAGCTTTCTGAAGG + Intergenic
1031698538 7:124892973-124892995 GTGTTCTAGTTGCATTTTCAGGG - Intronic
1037240014 8:16766479-16766501 GCGCTCTAGTAGCATTTTGAAGG - Intergenic
1038381206 8:27096046-27096068 ATTTTCTAGAAACATCCTGATGG - Intergenic
1039095219 8:33877060-33877082 AAGTTCTAGGAGCTTTCTGGAGG + Intergenic
1039791422 8:40878862-40878884 ATGTTCTATTAGCATTGAGTGGG + Intronic
1040064321 8:43132771-43132793 GAGTTCTAGTAGCTTTTTGATGG + Intergenic
1040561781 8:48528924-48528946 ATGTTGCAGTCCCATTCTGAAGG - Intergenic
1041672967 8:60511395-60511417 CTCTTCAAGTAGCTTTCTGAAGG + Intergenic
1043672157 8:82900325-82900347 ATGTTACAGTAGCATTCTTTAGG + Intergenic
1046842231 8:118872210-118872232 ATGTTCTTTTTGCACTCTGAAGG - Intergenic
1048929123 8:139297005-139297027 ATGTTGTATTAGCATCCTGGGGG - Intergenic
1052542627 9:29829955-29829977 ATTTTCTAGTTGTATTTTGAAGG - Intergenic
1053212189 9:36240045-36240067 AAGTTCTAGGAGCTTTCTGGAGG + Intronic
1055184020 9:73428205-73428227 ATTTTCTAATAGCATCATGATGG - Intergenic
1060136894 9:121166199-121166221 ATATTCTAGTAGTATACTGAGGG + Intronic
1187514428 X:19954447-19954469 TTGCTTAAGTAGCATTCTGATGG - Intronic
1187821076 X:23288740-23288762 ACGTTTTAGTATCATTCAGATGG - Intergenic
1189723291 X:43942749-43942771 ATGTTCTGGTAGTAGTCTGATGG - Intergenic
1190025460 X:46918108-46918130 TCCTTCTAGAAGCATTCTGAAGG - Intronic
1191950784 X:66589937-66589959 CAGTTCTAGGAGCATTCTGGAGG + Intergenic
1191954522 X:66629451-66629473 CAGTTCTAGGAGCTTTCTGAGGG - Intronic
1191994405 X:67076057-67076079 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
1193228703 X:79016560-79016582 CAGTTCTAGTAGCTTTCTGGAGG - Intergenic
1193989827 X:88292759-88292781 CAGTTCTAGTAGCTTTGTGATGG - Intergenic
1194529444 X:95026713-95026735 ATTTTCTATAAGTATTCTGAGGG + Intergenic
1196962344 X:121016844-121016866 ATGTGCTTTTAGCATGCTGAGGG + Intergenic
1197325023 X:125082230-125082252 ATATTCTAGTTACATCCTGATGG - Intergenic
1198510646 X:137347777-137347799 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic