ID: 936383145

View in Genome Browser
Species Human (GRCh38)
Location 2:112005365-112005387
Sequence AACTATATAGATTTTAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936383145_936383148 28 Left 936383145 2:112005365-112005387 CCCAGCTTAAAATCTATATAGTT 0: 1
1: 0
2: 1
3: 31
4: 233
Right 936383148 2:112005416-112005438 TCTAATTGAAATAGCTAGAAAGG 0: 1
1: 0
2: 2
3: 39
4: 314
936383145_936383149 29 Left 936383145 2:112005365-112005387 CCCAGCTTAAAATCTATATAGTT 0: 1
1: 0
2: 1
3: 31
4: 233
Right 936383149 2:112005417-112005439 CTAATTGAAATAGCTAGAAAGGG 0: 1
1: 0
2: 3
3: 33
4: 289
936383145_936383150 30 Left 936383145 2:112005365-112005387 CCCAGCTTAAAATCTATATAGTT 0: 1
1: 0
2: 1
3: 31
4: 233
Right 936383150 2:112005418-112005440 TAATTGAAATAGCTAGAAAGGGG 0: 1
1: 0
2: 2
3: 56
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936383145 Original CRISPR AACTATATAGATTTTAAGCT GGG (reversed) Intronic