ID: 936392183

View in Genome Browser
Species Human (GRCh38)
Location 2:112085426-112085448
Sequence GACCCAATTCTAGTTCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936392180_936392183 21 Left 936392180 2:112085382-112085404 CCTTCAAGTCCTGATTTAGATGT 0: 1
1: 0
2: 2
3: 26
4: 229
Right 936392183 2:112085426-112085448 GACCCAATTCTAGTTCCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 79
936392181_936392183 12 Left 936392181 2:112085391-112085413 CCTGATTTAGATGTCACTTTTTC 0: 1
1: 0
2: 1
3: 31
4: 264
Right 936392183 2:112085426-112085448 GACCCAATTCTAGTTCCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 79
936392179_936392183 30 Left 936392179 2:112085373-112085395 CCTACTTAGCCTTCAAGTCCTGA 0: 1
1: 0
2: 1
3: 22
4: 217
Right 936392183 2:112085426-112085448 GACCCAATTCTAGTTCCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936392183 Original CRISPR GACCCAATTCTAGTTCCCCC AGG Intronic
900837643 1:5018060-5018082 GAACCAATTATCGTTCCACCAGG - Intergenic
900980496 1:6043507-6043529 GCCCCAATTCTGGTGCCCACAGG + Intronic
904192467 1:28757053-28757075 GACCAAATTCTAGTTCCAGTGGG + Intronic
905014962 1:34771596-34771618 GACCTAATTCCAGGTACCCCTGG + Intronic
910472331 1:87568121-87568143 CACTCATTTCTATTTCCCCCAGG - Intergenic
915096997 1:153470196-153470218 TACCCAATTCTCCTTCCTCCCGG - Intergenic
916841242 1:168603509-168603531 CACCCAATTTCAGTTCTCCCAGG + Intergenic
920519202 1:206611022-206611044 GACCCAATTCTAGGAACACCAGG + Intronic
1062776516 10:153705-153727 GACCAAACTCTATTTCCCCTAGG - Intronic
1066518035 10:36185389-36185411 GCCCCAGTTCTAGGACCCCCAGG - Intergenic
1072051010 10:91702840-91702862 GCCCCACTTCTGGTTTCCCCTGG - Intergenic
1073797708 10:107006172-107006194 AACCCTATTCTAGGTCCTCCTGG + Intronic
1075637546 10:124039572-124039594 GACCCAGTTCCCGTTCACCCAGG - Intronic
1076393382 10:130120513-130120535 GGCCCAATTCCAGTTCTCCAGGG + Intergenic
1077836040 11:5929054-5929076 GACCCAAGTTTACTTCCCCAGGG + Intronic
1084307794 11:68298177-68298199 GCCCCATTTCTAGGTTCCCCAGG - Intergenic
1084489466 11:69470721-69470743 GACCCAAATCTCTTTCCCACGGG - Intergenic
1094151877 12:27293847-27293869 GACCCAACTCTAGTTGTCCAAGG - Intronic
1094414973 12:30206581-30206603 GATCCAGTTGTAGCTCCCCCAGG + Intergenic
1095581310 12:43803318-43803340 CTCCCAATTGTAGTTGCCCCAGG + Intronic
1097865249 12:64554682-64554704 ATCCCATTTCTAGTTCCCCTTGG - Intergenic
1099356472 12:81642019-81642041 GACACAATTCTAGTTATCCAAGG + Intronic
1100506849 12:95229666-95229688 GACTCAATTTTAGTTTTCCCTGG + Intronic
1111679379 13:91425317-91425339 CACACTATTCTAGTTCACCCAGG - Intronic
1114044561 14:18712433-18712455 GACTCAATTCTAGACCCACCAGG + Intergenic
1114048894 14:18903159-18903181 GACTCAATTCTAGACCCACCAGG + Intergenic
1114113668 14:19498774-19498796 GACTCAATTCTAGACCCACCAGG - Intergenic
1114115369 14:19616523-19616545 GACTCAATTCTAGACCCACCAGG - Intergenic
1122327705 14:100892301-100892323 GCCCTCATTCTAGTTCCACCAGG - Intergenic
1123504951 15:20932752-20932774 GACTCAATTCTAGACCCACCAGG + Intergenic
1123562196 15:21506446-21506468 GACTCAATTCTAGACCCACCAGG + Intergenic
1123598441 15:21943733-21943755 GACTCAATTCTAGACCCACCAGG + Intergenic
1126122662 15:45267605-45267627 AACCCAACTCGAGTTCACCCAGG - Intronic
1129707289 15:77801952-77801974 GCCCCAATTCTGGGTTCCCCAGG - Intronic
1133880464 16:9776936-9776958 GCCCCAATTCTGTGTCCCCCAGG - Intronic
1137709290 16:50555281-50555303 GAACCACTTCCAGTTCCCACAGG - Intronic
1140475217 16:75236517-75236539 GACCAAATTCTGGTTTGCCCAGG + Intronic
1144503090 17:15806567-15806589 GACTCAATTCAAGTCCACCCAGG + Intergenic
1148127178 17:45242901-45242923 GCCCCAAGTCTGGATCCCCCGGG + Intronic
1151505656 17:74525386-74525408 GACTCAATACTAGGACCCCCTGG + Intronic
1153414538 18:4832138-4832160 GACCCAATTCCAGCTCTGCCTGG + Intergenic
1157096192 18:44687455-44687477 CCCCCAATTCTATTTACCCCAGG - Intronic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
929558825 2:42942962-42942984 GACTCAATTCCAGTCCCCCTTGG + Intergenic
933225079 2:79738643-79738665 GACTCAATTCCACTTCCTCCTGG - Intronic
933560325 2:83878692-83878714 GACCCAAGTTTACTTCCCCAGGG - Intergenic
936392183 2:112085426-112085448 GACCCAATTCTAGTTCCCCCAGG + Intronic
938426209 2:131191415-131191437 GACTCAATTCTAGACCCACCAGG + Intronic
940021803 2:149163811-149163833 GACCCAATTGTTGACCCCCCAGG - Intronic
948675796 2:239595887-239595909 GACCCAATCCTTGTACCCACGGG + Intergenic
1175260075 20:57668704-57668726 CACCCATTTCCAGTTCCCCTGGG + Intronic
1178250981 21:31003321-31003343 GACACAGTTCTGGTTCCCCAAGG + Intergenic
1179058169 21:37955001-37955023 GACCCATTTTTAGTCCCCCAAGG - Intronic
1179644976 21:42770248-42770270 GGCCCATCTCTTGTTCCCCCCGG + Intronic
1180467379 22:15625543-15625565 GACTCAATTCTAGACCCACCAGG + Intergenic
1182025844 22:27118505-27118527 GACCCATTACTAGTCACCCCCGG - Intergenic
1184200423 22:42964839-42964861 AACACTATTCTAGTTACCCCTGG - Intronic
951507980 3:23470148-23470170 GACCCAATTTTAGGACCTCCTGG - Intronic
955563022 3:60213473-60213495 GACCCAAGTCAAGCTCCCACAGG + Intronic
956747359 3:72320417-72320439 AACCCAATTCTAGATGCCACTGG + Intergenic
957526156 3:81380610-81380632 GAACCAATTCTTGTGCCTCCAGG - Intergenic
968717341 4:2170351-2170373 GACCCGTTTCTAGTTCCTCTTGG + Intronic
969244008 4:5920879-5920901 GACCAAAATCTAGTACCCCTCGG - Intronic
978869353 4:113556667-113556689 CATCCATTTCTAGTTACCCCAGG + Intronic
989037025 5:37185142-37185164 GACCCAACTCTGGTCCCTCCTGG + Intronic
1006505002 6:34483468-34483490 GACCCAACTCTGGTGCCCACCGG - Intronic
1025806676 7:64839487-64839509 GACCCAAGTTTACTTCCCCAGGG - Intergenic
1027443168 7:78242132-78242154 AACTCAGTTCTAGTTCCCACTGG - Intronic
1032024518 7:128430829-128430851 GAGCCCAGTCCAGTTCCCCCAGG - Intergenic
1034734205 7:153413481-153413503 GACCCAAGTTTACTTCCCCAGGG - Intergenic
1041346418 8:56902899-56902921 GACCCACTGCTAGTTCCCCTAGG + Intergenic
1047516700 8:125561189-125561211 ACCCCAATTCTACTTCCCACAGG + Intergenic
1051749238 9:20324269-20324291 GACTCAATTCTAGCTCCTCAGGG + Intergenic
1053295869 9:36912568-36912590 GCCCCAGTTCTAGCTCCCCCAGG - Intronic
1055640775 9:78317164-78317186 AACCCAATTCTAGATCCCTGAGG - Intronic
1062378561 9:136275947-136275969 GACCCAGCTCTGGTTCCCGCTGG + Intergenic
1062704057 9:137925069-137925091 GAGCCCATCCTAGTTCCCCAGGG + Intronic
1194342535 X:92722313-92722335 GACCCATTTGTAGCTCCCTCAGG - Intergenic
1195298982 X:103508734-103508756 GACCCAAATCCACTTCCCCATGG + Intronic
1197808785 X:130422813-130422835 GGCTCAATTCTAGTTCTCCCAGG + Intergenic
1200650898 Y:5839002-5839024 GACCCATTTGTAGCTCCCTCAGG - Intergenic
1201770018 Y:17610374-17610396 GACCCAAGTTTACTTCCCCAGGG + Intergenic
1201831536 Y:18295613-18295635 GACCCAAGTTTACTTCCCCAGGG - Intergenic
1202628707 Y:56886512-56886534 GACCCAATACTACTTCCTCTTGG + Intergenic