ID: 936393729

View in Genome Browser
Species Human (GRCh38)
Location 2:112101439-112101461
Sequence CCTAACCCTACATTGTTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 3, 2: 29, 3: 69, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936393729 Original CRISPR CCTAACCCTACATTGTTCAA GGG (reversed) Intronic
902108004 1:14053727-14053749 CTAATCCCTGCATTGTTCAAGGG - Intergenic
902571720 1:17351523-17351545 CCTCACCCTTCAGGGTTCAAGGG - Intronic
903355509 1:22744275-22744297 CCTACCCCCACATTGTTCAAGGG - Intronic
905099317 1:35504681-35504703 CTAACCCCTACACTGTTCAAGGG + Intronic
905847950 1:41249038-41249060 CTAACCCCCACATTGTTCAAGGG - Intergenic
905900647 1:41580230-41580252 CCTCACCCTGCATTGTCCCATGG - Exonic
906693341 1:47807427-47807449 CCCAAGCCTTCATTGTTGAATGG - Intronic
907929289 1:58984416-58984438 CCTCACCCTACTTTAGTCAAAGG - Intergenic
909145198 1:71921369-71921391 TTTAAACCTGCATTGTTCAAAGG - Intronic
909361087 1:74759585-74759607 CCTAACTCCATGTTGTTCAAGGG - Intronic
909520844 1:76565824-76565846 CTCACCCCTACATTGTTCCAGGG - Intronic
909835307 1:80247278-80247300 CTAATCCCTGCATTGTTCAAGGG - Intergenic
909885261 1:80934097-80934119 CCTAACCCTTTATGGTTCAAGGG - Intergenic
910052895 1:82996988-82997010 CTTAACCCTGTATTGTTCAAGGG + Intergenic
910173507 1:84403181-84403203 CCTACCCCAGCATGGTTCAAGGG - Intronic
910302049 1:85717058-85717080 CCTAACCCAACAGTGTTGAGAGG + Intergenic
911456746 1:98134096-98134118 CCAACCCCTGCATTGTTCAAGGG - Intergenic
913647270 1:120870286-120870308 CCTAACCCTATGTTGTTCAAGGG + Intergenic
914079373 1:144392573-144392595 CCTAACCCTATATTGTTCAAGGG - Intergenic
914099806 1:144573929-144573951 CCTAACCCTATATTGTTCAAGGG + Intergenic
914174274 1:145261119-145261141 CCTAACCCTATGTTGTTCAAGGG - Intergenic
914299181 1:146363752-146363774 CCTAACCCTATGTTGTTCAAGGG - Intergenic
914528938 1:148502303-148502325 CCTAACCCTATGTTGTTCAAGGG - Intergenic
914637454 1:149564805-149564827 CCTAACCCTATGTTGTTCAAGGG + Intergenic
915824796 1:159064169-159064191 CTAATCCCTACATTGTTCAAGGG + Intronic
915997686 1:160580812-160580834 CAAACCCCTGCATTGTTCAAGGG - Intergenic
916385602 1:164264008-164264030 CCAACCCCTACGTTGTTTAAGGG - Intergenic
917092970 1:171372485-171372507 CCTAATCCTACATTCTTTATTGG - Intergenic
917949371 1:180014797-180014819 CCAACCCCCACATCGTTCAAAGG - Intronic
918604147 1:186401279-186401301 CCTAATCCTAAATTTTTAAAAGG + Exonic
919331270 1:196175249-196175271 CCTAACCCTGAATTGTTCAAGGG + Intergenic
920196367 1:204229950-204229972 CCTAACCCAATGTTGTTAAAAGG + Intronic
921299749 1:213739440-213739462 CTAACCCCTACGTTGTTCAAGGG + Intergenic
921543908 1:216451695-216451717 CCAACCCCTACTTTGTTCAGGGG - Intergenic
922369009 1:224891086-224891108 CCTTACCCTACTTTTTGCAATGG + Intergenic
922854624 1:228763967-228763989 CCAAACCCCACATTGTTTAGGGG - Intergenic
922949460 1:229546443-229546465 CCAACCCCTGCATTGTTCAAGGG + Intronic
923474798 1:234322219-234322241 CCATTCTCTACATTGTTCAAGGG - Intronic
923615648 1:235534884-235534906 CTAATCCCTGCATTGTTCAAGGG + Intergenic
924143600 1:241050996-241051018 CTAACCCCCACATTGTTCAAAGG + Intronic
1063260197 10:4379158-4379180 CCTGTCCCCACATTGTTCAAGGG + Intergenic
1063821702 10:9843659-9843681 CTAATCCCTGCATTGTTCAAGGG + Intergenic
1064741252 10:18437325-18437347 CATAACCTCTCATTGTTCAATGG - Intronic
1066237049 10:33495632-33495654 CCAACCCATGCATTGTTCAAGGG - Intergenic
1068368155 10:56078539-56078561 CATAACCCTATATTTCTCAAAGG - Intergenic
1069096399 10:64264825-64264847 CCAACCCCTGCATTGTTGAAGGG - Intergenic
1071016787 10:81006856-81006878 TTCACCCCTACATTGTTCAAAGG + Intergenic
1072687146 10:97544482-97544504 CCTAACCCTGCGTTGTTCAAGGG - Intronic
1072733236 10:97862295-97862317 CCTAACCCTGTGTTGTGCAAGGG - Intronic
1074195981 10:111185687-111185709 CTATCCCCTACATTGTTCAAGGG + Intergenic
1074910197 10:117901445-117901467 CCTAACCCTGTGTTGTTCAAGGG - Intergenic
1077206195 11:1345910-1345932 CCTCAGCCTGCATCGTTCAAGGG + Intergenic
1077486321 11:2839998-2840020 CCCAACCCTGCATTGTTCAAGGG - Intronic
1078997242 11:16715102-16715124 CCTAAACCTGCACTGTCCAACGG + Intronic
1080121710 11:28685434-28685456 CCAACCTCTGCATTGTTCAAGGG - Intergenic
1080591837 11:33731202-33731224 CCTAACCCTGCATTGTTTTAGGG + Intronic
1080972628 11:37296966-37296988 CTGTACCCCACATTGTTCAAGGG - Intergenic
1081279743 11:41194313-41194335 CTAACCCCTATATTGTTCAAGGG + Intronic
1081467108 11:43331191-43331213 CTAAGCCCTTCATTGTTCAAGGG - Intronic
1081843169 11:46218259-46218281 CCTAACCCCACAGAGTTCCATGG + Intergenic
1082053151 11:47789776-47789798 CTAAACCCTGCATTGTTCAAGGG - Intronic
1084755030 11:71232859-71232881 CCAACCTCTCCATTGTTCAAAGG + Intronic
1086186544 11:84024114-84024136 CCCAACCCTACATTGTTTAAGGG + Intronic
1087079327 11:94154667-94154689 CCGACCCCCACATTGTTCAAGGG - Intronic
1087126361 11:94630067-94630089 CCAAACCCCACATTTTTCAAGGG - Intergenic
1087177464 11:95108741-95108763 CCTCCCCCTCCATTGTTGAAAGG + Intronic
1087245181 11:95826653-95826675 CTAACCCCTCCATTGTTCAAGGG + Intronic
1087451759 11:98332302-98332324 CATAACCTAACATTGTGCAATGG - Intergenic
1088543993 11:110941614-110941636 CTAACCCCCACATTGTTCAAGGG - Intergenic
1089175534 11:116546411-116546433 CCAACCCCTGCATTATTCAAGGG + Intergenic
1092788155 12:12048525-12048547 CCTAACCCCACATTGTTCAAGGG - Intergenic
1092981843 12:13803304-13803326 CTAACCCCCACATTGTTCAAGGG + Intronic
1093180183 12:15958055-15958077 CTTATGCCTACACTGTTCAATGG - Intronic
1093204329 12:16228951-16228973 CCAACCCCTGCGTTGTTCAAGGG + Intronic
1093327332 12:17793989-17794011 CTAACCCCTACACTGTTCAAGGG - Intergenic
1093896679 12:24582707-24582729 CTAACCCCCACATTGTTCAAAGG - Intergenic
1094122554 12:26989495-26989517 ACAACCCCTACACTGTTCAAAGG + Intronic
1095610861 12:44126277-44126299 CTAACCCCTCCATTGTTCAAAGG + Intronic
1095716940 12:45356357-45356379 CCTACCCCTGTGTTGTTCAAGGG - Intronic
1095937115 12:47696916-47696938 ACTGACCCCACACTGTTCAAGGG + Intronic
1096479770 12:51931617-51931639 CCAAACCTCACCTTGTTCAAGGG + Intergenic
1097993795 12:65865319-65865341 CCAACCCCTGCATTGTTGAAGGG + Intronic
1098532815 12:71560112-71560134 CCTAACCCCTAGTTGTTCAAGGG - Intronic
1098542294 12:71670447-71670469 CTAAACCCTGCATTGTTCAAGGG - Intronic
1098986093 12:77014042-77014064 CCCACCCCTTCATTGTTTAAGGG + Intergenic
1099745569 12:86699549-86699571 CCTACCCCCATGTTGTTCAAGGG - Intronic
1100821364 12:98433796-98433818 CCCAGCCCCATATTGTTCAAGGG + Intergenic
1103551295 12:121739422-121739444 CCTAACCCCACCTTGTTCAAGGG - Intronic
1104253488 12:127119194-127119216 CTGACCCCTACATTGGTCAAGGG + Intergenic
1104496238 12:129242217-129242239 TTTAACCCTCCATTATTCAATGG + Intronic
1104871127 12:131997097-131997119 CTAATCCCCACATTGTTCAAGGG - Intronic
1105337138 13:19483659-19483681 CCAAACCCCAAATTGTTAAAAGG - Intronic
1106423592 13:29604644-29604666 TTCAATCCTACATTGTTCAAGGG - Intergenic
1108009808 13:45994362-45994384 CCTACCCCTTCATTGTTCAAGGG + Intronic
1108564805 13:51685333-51685355 CTAACCCCCACATTGTTCAAAGG - Intronic
1108584089 13:51852907-51852929 CCTAAGCACTCATTGTTCAAGGG - Intergenic
1109200029 13:59420027-59420049 CCTAACCTCACATTGTTCAAGGG - Intergenic
1109222702 13:59656385-59656407 CTAACCCCTGCATTGTTCAAAGG + Intergenic
1109598193 13:64585706-64585728 CCTTACTCTACATTTTCCAAAGG + Intergenic
1110638452 13:77792710-77792732 CATAACCCTATATTTCTCAAAGG - Intergenic
1110953539 13:81523765-81523787 CCAATGCCTGCATTGTTCAAGGG + Intergenic
1111270748 13:85880934-85880956 CCAACTCCTGCATTGTTCAAAGG - Intergenic
1111599376 13:90452139-90452161 CCTAACTCTGCTTTGTTCAAAGG + Intergenic
1111633120 13:90868592-90868614 CCAATCCCTGCATTGTTCAATGG - Intergenic
1111929303 13:94497390-94497412 CCTAACCCCATGATGTTCAAGGG - Intergenic
1112301926 13:98238902-98238924 CCAACCCCCACATTGTTCAAGGG + Intronic
1112388150 13:98959200-98959222 GCTAAGCACACATTGTTCAAAGG - Intronic
1112682883 13:101787556-101787578 CATAACCCTACATGGTTCTCAGG + Intronic
1115135615 14:30104058-30104080 CTCACCACTACATTGTTCAAGGG + Intronic
1117263554 14:54062069-54062091 CCCAACCCTGCATTGTTGAAGGG + Intergenic
1117950081 14:61074167-61074189 CTGACCCCCACATTGTTCAAAGG + Intronic
1118036519 14:61874267-61874289 TCCAAGCCCACATTGTTCAAGGG - Intergenic
1119578393 14:75750699-75750721 CTAAACCCCACATTGTTCAAGGG + Intronic
1119585315 14:75828621-75828643 CCAACCCCTGTATTGTTCAAGGG + Intronic
1119608898 14:76045067-76045089 CCAACACCCACATTGTTCAAGGG + Intronic
1121678918 14:95776604-95776626 CCCAACCTTACTTTTTTCAACGG + Intergenic
1202938440 14_KI270725v1_random:116670-116692 CCTGCCACAACATTGTTCAAAGG - Intergenic
1124425453 15:29559045-29559067 CCTAACCGTGTACTGTTCAAGGG + Intronic
1124870742 15:33539588-33539610 CTAACCCCTACATTGTTTAAGGG - Intronic
1125480790 15:40078497-40078519 CTAATCCCAACATTGTTCAAGGG + Intergenic
1126027426 15:44461216-44461238 CTAAACTCCACATTGTTCAAGGG - Intronic
1127434156 15:58939897-58939919 CCTAACCCTGAGTTGTTCAAGGG - Intronic
1129626005 15:77200420-77200442 CCAACCTCTACATTGTTCAAGGG + Intronic
1130207621 15:81892193-81892215 CCAATCCCCACTTTGTTCAAGGG - Intergenic
1130957094 15:88634955-88634977 CCAATCCCTATGTTGTTCAAGGG - Intergenic
1131756808 15:95573177-95573199 CCTAACCTTTTGTTGTTCAAGGG - Intergenic
1131911156 15:97204158-97204180 TCAAACCCTGCATTGTTCAAAGG - Intergenic
1132425390 15:101711764-101711786 CCTAACCCCACATTATGTAAGGG + Intronic
1132773330 16:1577528-1577550 CCTACCCCTGCATTGTTCAAGGG + Intronic
1133124828 16:3639941-3639963 CCAAACCCAACATTATTCAAAGG - Intronic
1134426330 16:14150343-14150365 CCAACCCCTACATTGTCCAAGGG - Intronic
1136223239 16:28842349-28842371 CTAACCCCTGCATTGTTCAAGGG + Intergenic
1136700858 16:32139637-32139659 CCTGCCACAACATTGTTCAAAGG + Intergenic
1136766797 16:32787822-32787844 CCTGCCACAACATTGTTCAAAGG - Intergenic
1136770506 16:32835518-32835540 CCTGCCACAACATTGTTCAAAGG - Intergenic
1136801298 16:33082556-33082578 CCTGCCACAACATTGTTCAAAGG + Intergenic
1136900100 16:34026475-34026497 CCTGCCACAACATTGTTCAAAGG + Intergenic
1136945113 16:34640536-34640558 CCTGCCACAACATTGTTCAAAGG + Intergenic
1136959168 16:34826068-34826090 CCTGCCACAACATTGTTCAAAGG + Intergenic
1136967288 16:34929375-34929397 CCTGCCACAACATTGTTCAAAGG + Intergenic
1137087908 16:36151487-36151509 CCTGCCACAACATTGTTCAAAGG + Intergenic
1137221482 16:46455959-46455981 CCTGCCACAACATTGTTCAAAGG - Intergenic
1137654176 16:50146106-50146128 CCCAACCCTGAATTGTTCAAGGG + Intergenic
1138070677 16:53990153-53990175 CCAATCCCTACACTGTTCAAAGG + Intronic
1138757905 16:59511407-59511429 CTAACCCCTACATTATTCAAGGG - Intergenic
1138948761 16:61884883-61884905 CTAACCCCTGCATTGTTCAAGGG + Intronic
1139218354 16:65151953-65151975 TCAAACCCTATGTTGTTCAAGGG - Intergenic
1142312487 16:89322162-89322184 CCAACCCCTGTATTGTTCAAGGG + Intronic
1203069192 16_KI270728v1_random:1050074-1050096 CCTGCCACAACATTGTTCAAAGG - Intergenic
1203072926 16_KI270728v1_random:1097622-1097644 CCTGCCACAACATTGTTCAAAGG - Intergenic
1144277504 17:13688155-13688177 CTAACCCCTGCATTGTTCAAGGG + Intergenic
1144279163 17:13707214-13707236 CTTAAACCCACGTTGTTCAAGGG + Intergenic
1144409334 17:14985407-14985429 ACCAACCCTGCCTTGTTCAAAGG + Intergenic
1144481255 17:15630986-15631008 CCAACCCCTACATTGTTCAAGGG + Intronic
1144773999 17:17775141-17775163 CTAACCCCCACATTGTTCAAGGG - Intronic
1144917058 17:18732745-18732767 CCAACCCCTACATTGTTCAAGGG - Intronic
1145691366 17:26743631-26743653 CCTGCCACAACATTGTTCAAAGG + Intergenic
1146097976 17:29950882-29950904 CTAACTCCTACATTGTTCAAGGG + Intronic
1148904551 17:50903894-50903916 CCTACCCATACATTGTAAAATGG + Intergenic
1149408106 17:56375535-56375557 CCTGTCCCTACCTTATTCAATGG - Intronic
1149599293 17:57882993-57883015 CTAACCCCTGCATTGTTCAATGG + Intronic
1151238588 17:72739811-72739833 CTAATCCCTGCATTGTTCAAGGG - Intronic
1152059709 17:78062785-78062807 CCTAATCCCAAACTGTTCAAGGG - Intronic
1153731158 18:8013264-8013286 CCAGCCCCTACACTGTTCAAGGG - Intronic
1154299304 18:13179108-13179130 CTACCCCCTACATTGTTCAAGGG + Intergenic
1154332945 18:13444571-13444593 CCAACCCCCAAATTGTTCAAAGG + Intronic
1154520775 18:15227323-15227345 CCTGCCACAACATTGTTCAAAGG - Intergenic
1155076806 18:22364610-22364632 CCAACCCCCACATTATTCAAGGG + Intergenic
1155106612 18:22673148-22673170 CCTAGCCCCCCATTGTTCAAGGG + Intergenic
1155555326 18:27012169-27012191 CTAAACCCTGTATTGTTCAAGGG - Intronic
1155650855 18:28139738-28139760 CCTAACACTACAGTTCTCAAAGG + Intronic
1156038351 18:32791897-32791919 CTGACCCCTACTTTGTTCAAGGG - Intergenic
1156148515 18:34215740-34215762 CCTAACCCCAGGTTGTTCAAGGG - Intronic
1156695292 18:39759067-39759089 CTAATCCCTGCATTGTTCAAGGG - Intergenic
1157195603 18:45617938-45617960 CCTAAGCCTTCATTTTTCTAGGG - Intronic
1157542398 18:48520960-48520982 CCGAACCCCACATGGTTAAAGGG + Intergenic
1158017558 18:52802404-52802426 GCTAACCCTGTTTTGTTCAAGGG - Intronic
1159139756 18:64379340-64379362 TCTAACCCTGCATTGTTCAAGGG - Intergenic
1159753160 18:72328080-72328102 CTAACCCCTACATTGTTAAAGGG - Intergenic
1159843566 18:73429723-73429745 ACTTACCATACATTATTCAATGG - Intergenic
1160425980 18:78779640-78779662 CCAACCCCTATGTTGTTCAATGG + Intergenic
1161706365 19:5823986-5824008 CCAACCCCTTCCTTGTTCAATGG + Exonic
1162611637 19:11759683-11759705 CTAATCCCTGCATTGTTCAAGGG + Intergenic
1163158842 19:15453096-15453118 CCTGACCTTACCTTGTTCACAGG + Exonic
1165253449 19:34558415-34558437 CGTTTCCCTACATTGATCAATGG - Intergenic
1167401083 19:49270006-49270028 CCTAACCCTACATCATTCAAGGG + Intergenic
1168577042 19:57520788-57520810 CTAATCCCCACATTGTTCAAGGG + Intergenic
1202671014 1_KI270709v1_random:51710-51732 CCTGCCACAACATTGTTCAAAGG + Intergenic
927746009 2:25621755-25621777 CCTAAACCAACATTTTTAAATGG + Intronic
928018308 2:27680025-27680047 CCCAACCCTTCATTGGTCATAGG + Intronic
929845664 2:45522965-45522987 CCAACCTCCACATTGTTCAAGGG + Intronic
930345160 2:50170813-50170835 CCAACCCCCACATTGTTCAAGGG - Intronic
932383850 2:71312372-71312394 CCAACCCCTATGTTGTTCAAGGG - Intronic
933321373 2:80779547-80779569 CTAACCCCTGCATTGTTCAAGGG - Intergenic
933523507 2:83405445-83405467 CCTAAGCCACCATTCTTCAAAGG + Intergenic
934250410 2:90348542-90348564 CCTGCCACAACATTGTTCAAAGG - Intergenic
934259155 2:91454874-91454896 CCTGCCACAACATTGTTCAAAGG + Intergenic
934330797 2:92066001-92066023 CCTGCCACAACATTGTTCAAAGG - Intergenic
934922122 2:98352910-98352932 CCAATCCCTGCATTGCTCAAGGG - Intronic
936393729 2:112101439-112101461 CCTAACCCTACATTGTTCAAGGG - Intronic
936960883 2:118073415-118073437 CTTAACCCTGCATTGTGCAATGG + Intergenic
937162392 2:119776927-119776949 CTAAACCCTGCATTGTTCAAAGG + Intronic
938045250 2:128113085-128113107 CCCAAACCTTTATTGTTCAAAGG + Exonic
938520127 2:132061093-132061115 CCTGCCACAACATTGTTCAAAGG - Intergenic
939283181 2:140091400-140091422 CTAACCCCTGCATTGTTCAAGGG + Intergenic
940315797 2:152326384-152326406 CCAAACCCTGAATTGTTCAAGGG + Intergenic
940952462 2:159691257-159691279 GCTGCCCCCACATTGTTCAAGGG - Intergenic
941387829 2:164874760-164874782 CAAATCCCTACATTGCTCAAGGG - Intergenic
941937763 2:170999698-170999720 CCAACCCCTATATTGTTCAAGGG - Intronic
941944645 2:171081545-171081567 GCTAAACCTACAATTTTCAAAGG + Intronic
942158498 2:173156997-173157019 CTAACCCCTGCATTGTTCAAGGG - Intronic
942265181 2:174217044-174217066 CCTAACCCCAGTATGTTCAAGGG + Intronic
942350707 2:175050094-175050116 CCAATGCCTACATTGTTCAAGGG - Intergenic
942909559 2:181226757-181226779 CTTACCCCAGCATTGTTCAAGGG + Intergenic
942937859 2:181579813-181579835 CCTATCCCAACATTATTCATTGG + Intronic
942991162 2:182204787-182204809 CCAACCCCTGTATTGTTCAAGGG + Intronic
943291336 2:186075835-186075857 CTAACCCCTACATTGTTCAAGGG + Intergenic
943561784 2:189472771-189472793 TCAATCTCTACATTGTTCAAGGG - Intronic
946499333 2:220229166-220229188 CCTAAACCCACATTGTTCAGGGG - Intergenic
946857697 2:223969198-223969220 CTAATCCCTGCATTGTTCAAGGG + Intergenic
947247873 2:228070062-228070084 CCCTAACCCACATTGTTCAAGGG - Intronic
947255752 2:228162130-228162152 CCTGACTCTACATGGCTCAAGGG - Intronic
947625027 2:231613802-231613824 CCTAACCGTAGCTTCTTCAAAGG + Intergenic
948422191 2:237866553-237866575 CCCACCCCTGCGTTGTTCAAGGG - Intronic
1168733618 20:110217-110239 CCTAACCCTGCATATTTCAAAGG - Intergenic
1169784195 20:9341257-9341279 CTAACCCCCACATTGTTCAAGGG - Intronic
1172353867 20:34265568-34265590 CTAACCCCTGCATTGTTCAAGGG + Intronic
1172391115 20:34566211-34566233 TCTAACCCTGCATTGTTACATGG + Intronic
1172858469 20:38027414-38027436 CTAACCCCCACATTGTTCAAGGG - Intronic
1173538954 20:43837307-43837329 CCAACCCCCGCATTGTTCAAGGG - Intergenic
1175569056 20:60005329-60005351 CTAACCCCCACATTGTTCAAGGG + Intronic
1176584875 21:8572466-8572488 CCTGCCACAACATTGTTCAAAGG + Intergenic
1177635708 21:23784341-23784363 CCCACCCCCATATTGTTCAAGGG + Intergenic
1177969781 21:27775975-27775997 CCCAACCCTGCATTGCTCATGGG + Intergenic
1178208655 21:30501404-30501426 CTAACCCCTACATTATTCAAGGG + Intergenic
1178614385 21:34118171-34118193 CATACCCCTACACTGTTCAAGGG - Intronic
1180267684 22:10549368-10549390 CCTGCCACAACATTGTTCAAAGG + Intergenic
1180524522 22:16242956-16242978 CCTGCCCCAAAATTGTTCAAAGG + Intergenic
1185097197 22:48816880-48816902 CCTAACCCCATGTGGTTCAAGGG + Intronic
1203236712 22_KI270732v1_random:9649-9671 CCTGCCACAACATTGTTCAAAGG + Intergenic
1203323889 22_KI270737v1_random:98084-98106 CCTGCCACAACATTGTTCAAAGG - Intergenic
949198576 3:1343323-1343345 CCAACCCCTGCATTGTTCAAAGG + Intronic
949647680 3:6116259-6116281 CCTAATCCTGCATTGTTCAAAGG - Intergenic
950626084 3:14248152-14248174 CATAGCACTACATTATTCAAAGG + Intergenic
953268671 3:41418134-41418156 CCTAACCCTGTGTTGTTCAAGGG - Intronic
953361156 3:42298035-42298057 CCTAACCCCATGATGTTCAAGGG - Intergenic
953965441 3:47301634-47301656 CCAACCCCCACATTGTTCAAGGG - Intronic
956495025 3:69815730-69815752 CTAACCCCTACATTGTTCAAGGG + Intronic
957427745 3:80062909-80062931 CCAACCTCTGCATTGTTCAAGGG - Intergenic
958768017 3:98394491-98394513 CCTGACCGTAGTTTGTTCAAGGG + Intergenic
958964758 3:100546964-100546986 CTAACCCCTGCATTGTTCAAGGG - Intronic
959110065 3:102112091-102112113 CCAACCCCTGCATTATTCAAAGG + Intronic
959152818 3:102628396-102628418 CCAATACCCACATTGTTCAAGGG + Intergenic
959235408 3:103715572-103715594 CTAACCCCCACATTGTTCAAGGG - Intergenic
961014406 3:123456596-123456618 CTAACCCCTGCATTGTTCAAGGG + Intergenic
961965620 3:130899193-130899215 CCAACCCCCACATTGTTCAAGGG - Intronic
962162718 3:133016172-133016194 CCAACCCCTGCATTGTTCAAGGG + Intergenic
962545503 3:136430216-136430238 CTAACCCCTGCATTGTTCAAGGG + Intronic
962708910 3:138069453-138069475 CTGACCCCTGCATTGTTCAAGGG + Intronic
962962529 3:140323933-140323955 CCTCACCCAATAATGTTCAAAGG + Intronic
963810310 3:149770290-149770312 CTAACCCCTGCATTGTTCAAAGG + Intronic
965187106 3:165478935-165478957 CCAACCCCAACATTGTCCAATGG - Intergenic
965333566 3:167407424-167407446 CTAATCCCCACATTGTTCAAGGG - Intergenic
965335643 3:167428630-167428652 CCTTACCCTACTTTTTGCAAAGG + Intergenic
966401459 3:179551858-179551880 CTAACCCCTGCATTGTTCAAGGG + Intergenic
966488096 3:180493529-180493551 CTTACCTCTACTTTGTTCAAAGG - Intergenic
966699734 3:182834779-182834801 CTAATCCCTGCATTGTTCAAGGG - Intronic
966760412 3:183413159-183413181 CCAGCTCCTACATTGTTCAAAGG - Intronic
967232510 3:187353672-187353694 CTAACCCCCACATTGTTCAAGGG - Intergenic
967313599 3:188129954-188129976 CTAACCCCTGCATTGTTCAAGGG - Intergenic
967523792 3:190468638-190468660 CTTCAACCTTCATTGTTCAAGGG + Intergenic
969649831 4:8459252-8459274 CCAACCCCCACTTTGTTCAAGGG + Intronic
969665618 4:8555773-8555795 CCTAACCCCACATTATTCAAGGG + Intergenic
970948543 4:21724872-21724894 CCTAACCATACAGTATCCAAAGG + Intronic
971032676 4:22658069-22658091 CCTAACCCTGGGTTGTTCAAGGG + Intergenic
971436567 4:26632208-26632230 CTAAACCCCACATTGTTTAAGGG - Intronic
971627775 4:28945133-28945155 CCAACCCCTGAATTGTTCAAGGG - Intergenic
971862792 4:32129771-32129793 CTTACCCCTATGTTGTTCAAGGG - Intergenic
972700433 4:41489772-41489794 CTGAACCTTGCATTGTTCAAGGG - Intronic
973172845 4:47166688-47166710 TTAATCCCTACATTGTTCAATGG + Intronic
973930017 4:55782724-55782746 CTAACCCCTACATTGTTAAAGGG + Intergenic
974495717 4:62624127-62624149 CTAATCCCTGCATTGTTCAAGGG - Intergenic
975795216 4:77999847-77999869 CCTAACCTTTCATTGTTCAAGGG - Intergenic
975857811 4:78643044-78643066 CCACACCCTGCATTGTCCAAGGG + Intergenic
976245569 4:83002922-83002944 CTAATCCCCACATTGTTCAAGGG + Intronic
977119024 4:93073569-93073591 CTAAACTCTGCATTGTTCAAGGG + Intronic
977919569 4:102627979-102628001 CCTAACCCTACATCAATCACTGG + Intergenic
978084171 4:104629978-104630000 ACTAACCCTCACTTGTTCAATGG + Intergenic
978420446 4:108527122-108527144 CTTAATCCTGAATTGTTCAAAGG + Intergenic
978469287 4:109045316-109045338 CTCACCCCCACATTGTTCAAGGG + Intronic
979038108 4:115751509-115751531 CCTAACCCCTGGTTGTTCAAGGG - Intergenic
979923460 4:126529206-126529228 CCTAACCTAATGTTGTTCAAAGG + Intergenic
980211519 4:129794516-129794538 CCTAACCACATGTTGTTCAAGGG + Intergenic
980487706 4:133480747-133480769 CTTAACCCCAAGTTGTTCAAAGG + Intergenic
980718163 4:136655974-136655996 CCTAACCCTACAATATTAAGAGG + Intergenic
981421935 4:144560782-144560804 TTTAAACCTATATTGTTCAAGGG + Intergenic
982111512 4:152060636-152060658 CCAACCCCTGCGTTGTTCAAGGG - Intergenic
982669189 4:158299570-158299592 CCTAATCCTACTTTGGCCAAGGG - Intergenic
982846755 4:160262919-160262941 CTAACCCCTGCATTGTTCAAGGG - Intergenic
982953232 4:161727610-161727632 CCTAACCCTGCATTTTTGCATGG + Intronic
983344818 4:166514777-166514799 CCAAGCCCCTCATTGTTCAAGGG - Intergenic
983510980 4:168609487-168609509 CCTGACCCCACATTGGGCAAGGG + Intronic
983692403 4:170486798-170486820 CTAACCCCCACATTGTTCAAGGG - Intergenic
983741927 4:171145686-171145708 CATAACCCTGCATTATTTAAGGG + Intergenic
984984383 4:185313706-185313728 CTAACCCCCACATTGTTCAAGGG - Intronic
985106864 4:186508658-186508680 CCTAACCCCGTGTTGTTCAAGGG - Intronic
987590918 5:19924923-19924945 CCAATCCCTGCCTTGTTCAAGGG - Intronic
987664441 5:20918951-20918973 CCAACCCCTACACTGTTCAAAGG - Intergenic
987754692 5:22085656-22085678 CCTTCCCTTATATTGTTCAATGG - Intronic
988220781 5:28344383-28344405 CTAAGCCCCACATTGTTCAAGGG + Intergenic
988294615 5:29339792-29339814 CCAATCCCTATGTTGTTCAAAGG + Intergenic
988596551 5:32597660-32597682 TTTGACCCTGCATTGTTCAAGGG - Intronic
988758242 5:34283242-34283264 CCAACCCCTACACTGTTCAAAGG + Intergenic
989650047 5:43677879-43677901 CTAACCCCTACATTGTTCAAGGG - Intronic
989978534 5:50613680-50613702 CCTAACCCTATGTTGTTCAAGGG + Intergenic
990863598 5:60355547-60355569 CCAACCCCCACCTTGTTCAAGGG - Intronic
991209344 5:64086407-64086429 CATAATCCTACATTTCTCAAAGG + Intergenic
991431416 5:66551703-66551725 CATAAGCCTACATTGCACAAAGG - Intergenic
992485964 5:77195543-77195565 CTTACCCCCACAGTGTTCAAGGG - Intergenic
992486597 5:77202966-77202988 CCTAACACTGTGTTGTTCAAGGG + Intergenic
992956102 5:81910027-81910049 CTTAAACCTATGTTGTTCAAGGG - Intergenic
992965722 5:81997867-81997889 CATAACTCTATATTTTTCAAAGG - Intronic
993064912 5:83086236-83086258 CTAACCCCTATATTGTTCAAGGG - Intronic
994130011 5:96216307-96216329 CTAACCCCCACATTGTTCAAGGG + Intergenic
995498326 5:112773425-112773447 CCAATCCCTGAATTGTTCAAGGG - Intronic
995634107 5:114165895-114165917 CCTAACCCCACATTTTTCAAGGG + Intergenic
995952696 5:117735613-117735635 CCAACCCCTTCATTGTTCAAGGG + Intergenic
1001383747 5:171320974-171320996 CTAACCCCCACATTGTTCAAGGG + Intergenic
1001663629 5:173414659-173414681 CCAACCCCTGCGTTGTTCAAGGG + Intergenic
1002913786 6:1511846-1511868 TCTACCCCCACACTGTTCAAGGG + Intergenic
1004173281 6:13315882-13315904 CCTAAACCTACACTACTCAAAGG + Intronic
1004576016 6:16895784-16895806 CCCAAACCTGCATTGTTCAAGGG + Intergenic
1005069368 6:21850332-21850354 CCTACCCCCACATTGTTTAAGGG + Intergenic
1006537245 6:34709620-34709642 CCTTAGCATACATTTTTCAAGGG + Intergenic
1006976963 6:38111834-38111856 CCAAACCCCATGTTGTTCAAGGG + Intronic
1008722444 6:54372665-54372687 CCTAACCCTAGATTCTGCAGTGG - Intronic
1009633609 6:66234153-66234175 CCTACCCCTCCATTGTTCAAGGG - Intergenic
1011848726 6:91600001-91600023 CTCAAAACTACATTGTTCAAGGG + Intergenic
1012105956 6:95158693-95158715 CTAATCCCCACATTGTTCAAGGG - Intergenic
1012162647 6:95905447-95905469 CCTAGCCCCACACTGCTCAAAGG + Intergenic
1012404467 6:98879336-98879358 CCTAAACCTACATTGTTTTAGGG + Intronic
1013437239 6:110122875-110122897 CTTACCCCTACACTGTTCAAGGG + Intronic
1013554489 6:111242047-111242069 CCAACCCCTGCATTGTTCAATGG - Intergenic
1013856523 6:114580263-114580285 CTAACCCCTACATTGTTCAAGGG - Intergenic
1013901172 6:115157469-115157491 CTAACCCCCACATTGTTCAAGGG + Intergenic
1014269830 6:119324466-119324488 CCAATCCCTGCATTGTTCAAGGG + Intronic
1014693645 6:124592496-124592518 CCTAACACTTCACTGTTGAAAGG + Intronic
1015097360 6:129431549-129431571 CCAACCCCTGCATTGGTCAAGGG - Intronic
1015255480 6:131174880-131174902 CCAATCCCCACATTGTTCAAAGG - Intronic
1016064287 6:139662964-139662986 CTAACCCCTACATTGTTCAAGGG - Intergenic
1016204974 6:141458134-141458156 CCTTACCCTACTTTTTGCAACGG + Intergenic
1016733522 6:147451499-147451521 CCTACCCCTGAATTGTTCAAGGG - Intergenic
1017441668 6:154470052-154470074 TTCAAACCTACATTGTTCAAGGG + Intronic
1017652177 6:156593763-156593785 CTAACCCCCACATTGTTCAAGGG + Intergenic
1017795809 6:157843242-157843264 CTAACCCCCACATTGTTCAAGGG - Intronic
1018570789 6:165207578-165207600 CCTAACTCCACATTGTTCAAGGG - Intergenic
1019029974 6:169001486-169001508 CCTAACCCTGCCTTGCTCAAGGG - Intergenic
1019900926 7:4020136-4020158 CCTGACCCTTCTTTGTTCGAGGG + Intronic
1020516138 7:9122037-9122059 CTTAACCCTACATTATGAAATGG - Intergenic
1021062852 7:16134606-16134628 CCCAACCCAATGTTGTTCAAGGG + Intronic
1021352728 7:19615326-19615348 CTAAGCCCTGCATTGTTCAAGGG - Intergenic
1022515565 7:30972929-30972951 ACTAAACCCACATTGTTCAAGGG - Intronic
1024407176 7:48995145-48995167 CCGACCCCCTCATTGTTCAAGGG - Intergenic
1024806222 7:53144140-53144162 CCTGCCACAACATTGTTCAAAGG - Intergenic
1025489092 7:61089454-61089476 CCTGCCACAACATTGTTCAAAGG - Intergenic
1025552137 7:62263946-62263968 CCTGCCACAACATTGTTCAAAGG - Intergenic
1025557943 7:62333074-62333096 CCTGCCACAACATTGTTCAAAGG - Intergenic
1025564736 7:62419717-62419739 CCTGCCACAACATTGTTCAAAGG + Intergenic
1025623708 7:63198612-63198634 CTTACCCCTGCATTGTTCAAAGG - Intergenic
1025886142 7:65595111-65595133 CCTGCCACAACATTGTTCAAAGG - Intergenic
1026107312 7:67431439-67431461 CCCAACTCTACCTTGTTCAAGGG + Intergenic
1026611292 7:71862188-71862210 CCACACCCTAGATTTTTCAAAGG - Intronic
1027571712 7:79876475-79876497 CCACCCCCCACATTGTTCAAGGG - Intergenic
1028017118 7:85730091-85730113 CCTAACACTGCATTCTTCAAGGG + Intergenic
1028113574 7:86972352-86972374 CCTAACCCTCCTTTGTTCTCAGG + Intronic
1028305488 7:89258576-89258598 CCTAACCCCCATTTGTTCAAGGG - Intronic
1028455815 7:91036844-91036866 CCAACCCCTGCATTGTTCAAGGG + Intronic
1028628902 7:92911463-92911485 CCGACCTCTGCATTGTTCAAGGG + Intergenic
1029012708 7:97279191-97279213 TTAAACCCTTCATTGTTCAAAGG - Intergenic
1029049370 7:97668563-97668585 CTTAACCCTACATTTTAGAAGGG + Intergenic
1030565472 7:111149377-111149399 CTAAACCCCACGTTGTTCAAGGG - Intronic
1031050574 7:116940877-116940899 CCTAACCCCGCATTGTTCAAAGG + Intergenic
1031165898 7:118226329-118226351 CCAACCCCTACATTGTTCAAGGG - Intronic
1031537379 7:122952067-122952089 CCAACCCCCACATTGTTCTAGGG - Intergenic
1032440528 7:131939518-131939540 CTAAACCCCATATTGTTCAAGGG - Intergenic
1033197795 7:139342019-139342041 CCTTTCCCCACATTGCTCAAGGG - Intronic
1033429431 7:141275513-141275535 CCTTCCCCTACAGGGTTCAAAGG - Intronic
1036093220 8:5692318-5692340 CCTAACTCTAAACTTTTCAAGGG + Intergenic
1036450240 8:8859860-8859882 CCAATGCCTGCATTGTTCAAGGG + Intronic
1036532908 8:9612721-9612743 CTAACCCCTGCATTGTTCAAGGG - Intronic
1037189631 8:16107544-16107566 CCAACCTCTGCATTGTTCAAGGG + Intergenic
1038868267 8:31463676-31463698 GCTCACACTACTTTGTTCAATGG + Intergenic
1040636536 8:49280868-49280890 CTAACTCCTACATTGTTCAAGGG - Intergenic
1040639763 8:49319817-49319839 CTAACCCCTGCATTGTTCAAGGG - Intergenic
1040856916 8:51958141-51958163 CTAACTCCTACATTGTTCAAAGG + Intergenic
1041124335 8:54620215-54620237 CATAACACTACTTTGGTCAATGG + Intronic
1041335956 8:56783764-56783786 CTGACCCCTGCATTGTTCAAGGG + Intergenic
1041484065 8:58354658-58354680 CTAGACCCCACATTGTTCAAGGG + Intergenic
1041525849 8:58804684-58804706 CCGACCCCTGCATTGTTCGAGGG + Intergenic
1042054263 8:64747334-64747356 CCAACCTCTACCTTGTTCAAAGG - Intronic
1042502965 8:69529619-69529641 GCAGACCCTACATTGTTCTAAGG + Intronic
1043182642 8:77105495-77105517 AGTAACCCTGCATTGCTCAAGGG - Intergenic
1043939520 8:86181002-86181024 CCAATCTGTACATTGTTCAAGGG + Intergenic
1044210606 8:89545495-89545517 CTAAACCCTATATTGTTCAAGGG - Intergenic
1045745317 8:105412211-105412233 CCTTCCCCTTCATTTTTCAATGG + Intronic
1046165844 8:110433782-110433804 CCAACCCCTACATTATTCAATGG - Intergenic
1047320242 8:123772617-123772639 CCTAAACCCATGTTGTTCAAGGG - Intronic
1049816729 8:144606713-144606735 CTAAACCCTAAGTTGTTCAAGGG + Intergenic
1050069837 9:1799115-1799137 CCAAAGTCTACATTGTTCCAGGG + Intergenic
1050600136 9:7242285-7242307 CTAATCCCTGCATTGTTCAAGGG + Intergenic
1050972928 9:11899895-11899917 TTAAACCCCACATTGTTCAAGGG - Intergenic
1053699412 9:40673929-40673951 CCTGCCACAACATTGTTCAAAGG - Intergenic
1053945408 9:43304073-43304095 CCTGCCACAACATTGTTCAAAGG - Intergenic
1054310701 9:63473330-63473352 CCTGCCACAACATTGTTCAAAGG - Intergenic
1054409491 9:64797481-64797503 CCTGCCACAACATTGTTCAAAGG - Intergenic
1054442652 9:65281292-65281314 CCTGCCACAACATTGTTCAAAGG - Intergenic
1055205500 9:73724501-73724523 ACTAACCTTACATTGTTCAAGGG + Intergenic
1055739861 9:79376095-79376117 CCTAATCCTGTGTTGTTCAAAGG - Intergenic
1056340636 9:85627996-85628018 CCAACCTCTGCATTGTTCAAGGG + Intronic
1056366865 9:85913913-85913935 CCCAAACCCGCATTGTTCAAGGG + Intergenic
1056570755 9:87812697-87812719 CCTCACCCCACATTTTGCAAGGG - Intergenic
1056878357 9:90361946-90361968 CTGAACCTTGCATTGTTCAAGGG - Intergenic
1056964423 9:91154115-91154137 CTAACCCCTGCATTGTTCAAGGG - Intergenic
1057513796 9:95703831-95703853 CTAACCACTACATTGTTCAAGGG + Intergenic
1057626459 9:96681990-96682012 CTAACCCCTGCATTGTTCAAGGG - Intergenic
1057737120 9:97673278-97673300 CCTAACCCCATGTTGTTCAAGGG + Exonic
1057952314 9:99379327-99379349 CCAAGCCCCACATTGTTCAAGGG + Intergenic
1058291825 9:103252018-103252040 CTAACCCCTGCATTGTTCAAGGG - Intergenic
1058320399 9:103622909-103622931 CTTGCCCCCACATTGTTCAAGGG + Intergenic
1060452491 9:123756277-123756299 CTTAAACCCATATTGTTCAAGGG + Intronic
1203580743 Un_KI270746v1:981-1003 CCTGCCACAACATTGTTCAAAGG + Intergenic
1203588543 Un_KI270747v1:32651-32673 CCTGCCACAACATTGTTCAAAGG - Intergenic
1203614783 Un_KI270749v1:49985-50007 CCTGCCACAACATTGTTCAAAGG + Intergenic
1185882259 X:3751870-3751892 CCTACATCTACATTGTTGAATGG - Intergenic
1185910859 X:3979759-3979781 CTAATCCCCACATTGTTCAAGGG - Intergenic
1187342745 X:18435921-18435943 CTAACCCCTACCTTGTTCAAGGG - Intronic
1188798760 X:34500477-34500499 ACTTGCCCTACATTGTTCTAGGG + Intergenic
1190814757 X:53920119-53920141 CTTAACCCTGCATTGTTCAAAGG - Intergenic
1190823922 X:53999490-53999512 CCAACCTCCACATTGTTCAAGGG + Intronic
1191605314 X:63056149-63056171 CATAATCCTACATTTCTCAAAGG + Intergenic
1192225467 X:69224306-69224328 CCCATCCCTACATTTTACAAAGG + Intergenic
1192459743 X:71306882-71306904 CCCAACCTTGCATTGTTCAAGGG - Intergenic
1195506591 X:105665183-105665205 CTAACCCCTGCATTGTTCAAGGG + Intronic
1195517509 X:105794217-105794239 AATACCCCTGCATTGTTCAAAGG - Intergenic
1195636727 X:107125415-107125437 CTAAACCCTTCATTGTTGAAGGG + Intronic
1197689567 X:129483300-129483322 CCCAACACTACAGTGTTCAGAGG + Intronic
1197705095 X:129629197-129629219 CTCAAACCCACATTGTTCAAGGG - Intergenic
1198437547 X:136631803-136631825 CCTAACCCCCAGTTGTTCAAGGG + Intergenic
1199433616 X:147788138-147788160 CCTAACCTTACTTTGAACAAAGG + Intergenic
1200301708 X:154983054-154983076 CCAACCCCCACATTGTTCAAGGG + Intronic
1201292482 Y:12434424-12434446 CACTACCCCACATTGTTCAAGGG - Intergenic